Rh6CG419200

Belongs to the cytochrome P450 family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Forward (+)
60235491 .. 60235802
312 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG419200.1

Sequence Viewer

Length: 312 bp
ATGAAAACCCTGATTAATGAACAAAAGAAGCGAATTGATTCAGGCGAGGAAGTAAATTGTTTTGTCGACTTCTTGCTCTCTGAAGCAAAAACATTGTCGTCGACGCTTACAATGGAACAAATAACTATGTTGGTTTGGGAGATAATTCTTGAGACAGCCGATACTACATTGGTGACAACAGAATGGGCTATGTATCAACTCGGTAAAGAACTAAAGATCCTATCCGCCAGGAACGTCTTTATGAAGAAATTCGAGTTGTTTGTGGATCGGAAAAGATTAGTGAGGAACACTTGCCCTAACTACCATACCTGA

Protein Analysis

103

Amino Acids

12.08

Weight (kDa)

6.58

Isoelectric Point (pI)

28.54

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
p450 PF00067 2 - 73 2.7e-08 Cytochrome P450
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 66, 101
AciI CCGC 1 cut(s) 225
AclWI GGATC 2 cut(s) 211, 273
AcsI RAATTY 1 cut(s) 248
AcuI CTGAAG 1 cut(s) 102
AjnI CCWGG 1 cut(s) 227
AloI GAACNNNNNNTCC 2 cut(s) 201, 233
Alw26I GTCTC 1 cut(s) 146
AlwI GGATC 2 cut(s) 211, 273
ApoI RAATTY 1 cut(s) 248
ArsI GACNNNNNNTTYG 2 cut(s) 80, 112
AseI ATTAAT 1 cut(s) 15
Asp700I GAANNNNTTC 2 cut(s) 37, 248
AsuHPI GGTGA 1 cut(s) 184
BciT130I CCWGG 1 cut(s) 229
BcoDI GTCTC 1 cut(s) 146
Bme1390I CCNGG 1 cut(s) 229
BmrFI CCNGG 1 cut(s) 229
BpuEI CTTGAG 1 cut(s) 170
BseBI CCWGG 1 cut(s) 229
BsmAI GTCTC 1 cut(s) 146
Bsp143I GATC 2 cut(s) 216, 265
BspACI CCGC 1 cut(s) 225
BspPI GGATC 2 cut(s) 211, 273
BssMI GATC 2 cut(s) 216, 265
Bst2UI CCWGG 1 cut(s) 229
BstKTI GATC 2 cut(s) 219, 268
BstMAI GTCTC 1 cut(s) 146
BstMBI GATC 2 cut(s) 216, 265
BstNI CCWGG 1 cut(s) 229
BstSCI CCNGG 1 cut(s) 227
BstX2I RGATCY 1 cut(s) 216
BstYI RGATCY 1 cut(s) 216
CseI GACGC 1 cut(s) 112
CviJI RGCY 2 cut(s) 158, 188
CviKI_1 RGCY 2 cut(s) 158, 188
DpnI GATC 2 cut(s) 218, 267
DpnII GATC 2 cut(s) 216, 265
EciI GGCGGA 1 cut(s) 214
Eco57I CTGAAG 1 cut(s) 102
EcoRII CCWGG 1 cut(s) 227
FaiI YATR 4 cut(s) 128, 191, 242, 306
FblI GTMKAC 2 cut(s) 66, 101
HgaI GACGC 1 cut(s) 112
HincII GTYRAC 2 cut(s) 67, 102
HindII GTYRAC 2 cut(s) 67, 102
HinfI GANTC 1 cut(s) 38
HphI GGTGA 1 cut(s) 184
Hpy166II GTNNAC 2 cut(s) 67, 102
Hpy188I TCNGA 2 cut(s) 82, 270
Hpy188III TCNNGA 1 cut(s) 149
Hpy8I GTNNAC 2 cut(s) 67, 102
Hpy99I CGWCG 2 cut(s) 103, 106
HpyCH4IV ACGT 1 cut(s) 234
HpySE526I ACGT 1 cut(s) 234
Kzo9I GATC 2 cut(s) 216, 265
LpnPI CCDG 4 cut(s) 23, 27, 214, 241
MaeII ACGT 1 cut(s) 234
MaeIII GTNAC 1 cut(s) 172
MalI GATC 2 cut(s) 218, 267
MboI GATC 2 cut(s) 216, 265
MboII GAAGA 1 cut(s) 256
MflI RGATCY 1 cut(s) 216
MluCI AATT 4 cut(s) 33, 55, 144, 248
MnlI CCTC 2 cut(s) 40, 276
MroXI GAANNNNTTC 2 cut(s) 37, 248
MseI TTAA 1 cut(s) 15
MspR9I CCNGG 1 cut(s) 229
MvaI CCWGG 1 cut(s) 229
NdeII GATC 2 cut(s) 216, 265
NmuCI GTSAC 1 cut(s) 172
PdmI GAANNNNTTC 2 cut(s) 37, 248
PfeI GAWTC 1 cut(s) 38
PshBI ATTAAT 1 cut(s) 15
Psp6I CCWGG 1 cut(s) 227
PspGI CCWGG 1 cut(s) 227
PsuI RGATCY 1 cut(s) 216
SalI GTCGAC 2 cut(s) 65, 100
SaqAI TTAA 1 cut(s) 15
Sau3AI GATC 2 cut(s) 216, 265
ScrFI CCNGG 1 cut(s) 229
SetI ASST 2 cut(s) 237, 311
SgrDI CGTCGACG 1 cut(s) 100
SmlI CTYRAG 1 cut(s) 149
SmoI CTYRAG 1 cut(s) 149
Sse9I AATT 4 cut(s) 33, 55, 144, 248
SsiI CCGC 1 cut(s) 225
StyD4I CCNGG 1 cut(s) 227
TaiI ACGT 1 cut(s) 237
TaqI TCGA 3 cut(s) 66, 101, 252
TasI AATT 4 cut(s) 33, 55, 144, 248
TfiI GAWTC 1 cut(s) 38
Tru1I TTAA 1 cut(s) 15
Tru9I TTAA 1 cut(s) 15
TseFI GTSAC 1 cut(s) 172
Tsp45I GTSAC 1 cut(s) 172
TspDTI ATGAA 3 cut(s) 17, 33, 257
VspI ATTAAT 1 cut(s) 15
XapI RAATTY 1 cut(s) 248
XmiI GTMKAC 2 cut(s) 66, 101
XmnI GAANNNNTTC 2 cut(s) 37, 248
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.