Rh6DG163700

Hemiasterlin resistant protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Reverse (-)
25092071 .. 25096303
4233 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG163700.1

Sequence Viewer

Length: 369 bp
ATGGCTCGCAGAAGCTCAGGAGGTCGATCTGCCCGCCCAGCTCCTCGTCGGGCTCCAGCACCAGCACCAGTTCGTCAGGCTCCTCCCCCGGCTCCTGCACAAAGTGGAAGCGGTGGATCCATGCTTGGAGGGATCGGATCAACCATAGCCCAGGGAATGGCTTTTGGAGGTGGAAGTGCTGTTGCACACAGGGCCGTGGATGCTGTGATGGGTCCTCGCACCATTCAACATGAAACGGTAGCCTCTGAGGCCTCTGCTGCTCCAGCATCCATGGCTAGCTCTGATGCATGCAGTATTCACTCTAAGGCTTTCCAAGATGTATGCAATACTCTTCTACTTCCTTTATCTTTTATTTTCTTGCAACTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

122

Amino Acids

12.19

Weight (kDa)

11.14

Isoelectric Point (pI)

77.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 157
AciI CCGC 2 cut(s) 34, 111
AclWI GGATC 4 cut(s) 111, 124, 140, 145
AdeI CACNNNGTG 1 cut(s) 104
AfiI CCNNNNNNNGG 1 cut(s) 157
AgsI TTSAA 1 cut(s) 227
AjnI CCWGG 1 cut(s) 150
AluBI AGCT 3 cut(s) 15, 41, 279
AluI AGCT 3 cut(s) 15, 41, 279
AlwI GGATC 4 cut(s) 111, 124, 140, 145
AoxI GGCC 2 cut(s) 192, 249
ApeKI GCWGC 1 cut(s) 257
AspS9I GGNCC 2 cut(s) 192, 212
AsuC2I CCSGG 1 cut(s) 89
AsuNHI GCTAGC 1 cut(s) 275
AvaII GGWCC 1 cut(s) 212
BamHI GGATCC 1 cut(s) 116
BanII GRGCYC 1 cut(s) 55
BbvI GCAGC 1 cut(s) 244
BccI CCATC 1 cut(s) 202
BceAI ACGGC 1 cut(s) 179
BciT130I CCWGG 1 cut(s) 152
BcnI CCSGG 1 cut(s) 89
BfaI CTAG 1 cut(s) 276
BfmI CTRYAG 1 cut(s) 365
BglI GCCNNNNNGGC 1 cut(s) 248
BisI GCNGC 1 cut(s) 258
BlsI GCNGC 1 cut(s) 259
Bme1390I CCNGG 2 cut(s) 89, 152
Bme18I GGWCC 1 cut(s) 212
BmgT120I GGNCC 2 cut(s) 192, 212
BmiI GGNNCC 5 cut(s) 54, 81, 93, 118, 213
BmrFI CCNGG 2 cut(s) 89, 152
BmsI GCATC 3 cut(s) 190, 274, 275
BmtI GCTAGC 1 cut(s) 279
BpmI CTGGAG 2 cut(s) 39, 246
Bpu10I CCTNAGC 1 cut(s) 16
BpuMI CCSGG 1 cut(s) 89
BsaJI CCNNGG 5 cut(s) 87, 150, 151, 195, 270
Bsc4I CCNNNNNNNGG 1 cut(s) 157
Bse1I ACTGG 1 cut(s) 68
BseBI CCWGG 1 cut(s) 152
BseDI CCNNGG 5 cut(s) 87, 150, 151, 195, 270
BseGI GGATG 2 cut(s) 205, 266
BseLI CCNNNNNNNGG 1 cut(s) 157
BseMII CTCAG 2 cut(s) 30, 237
BseNI ACTGG 1 cut(s) 68
BseRI GAGGAG 2 cut(s) 33, 72
BseXI GCAGC 1 cut(s) 244
BseYI CCCAGC 1 cut(s) 37
BsgI GTGCAG 1 cut(s) 81
BshFI GGCC 2 cut(s) 194, 251
BsiSI CCGG 1 cut(s) 89
BslI CCNNNNNNNGG 1 cut(s) 157
BsnI GGCC 2 cut(s) 194, 251
Bsp1286I GDGCHC 1 cut(s) 55
Bsp143I GATC 4 cut(s) 26, 116, 132, 137
Bsp19I CCATGG 1 cut(s) 270
BspACI CCGC 2 cut(s) 34, 111
BspANI GGCC 2 cut(s) 194, 251
BspCNI CTCAG 2 cut(s) 29, 238
BspLI GGNNCC 5 cut(s) 54, 81, 93, 118, 213
BspOI GCTAGC 1 cut(s) 279
BspPI GGATC 4 cut(s) 111, 124, 140, 145
BsrI ACTGG 1 cut(s) 68
BssECI CCNNGG 5 cut(s) 87, 150, 151, 195, 270
BssMI GATC 4 cut(s) 26, 116, 132, 137
BssT1I CCWWGG 1 cut(s) 270
Bst2UI CCWGG 1 cut(s) 152
Bst4CI ACNGT 2 cut(s) 238, 366
Bst6I CTCTTC 1 cut(s) 336
BstC8I GCNNGC 4 cut(s) 7, 34, 277, 289
BstDEI CTNAG 3 cut(s) 16, 246, 303
BstDSI CCRYGG 2 cut(s) 195, 270
BstF5I GGATG 2 cut(s) 205, 266
BstKTI GATC 4 cut(s) 29, 119, 135, 140
BstMBI GATC 4 cut(s) 26, 116, 132, 137
BstMWI GCNNNNNNNGC 7 cut(s) 38, 191, 200, 248, 257, 263, 272
BstNI CCWGG 1 cut(s) 152
BstNSI RCATGY 1 cut(s) 291
BstSCI CCNGG 2 cut(s) 87, 150
BstSFI CTRYAG 1 cut(s) 365
BstV1I GCAGC 1 cut(s) 244
BstX2I RGATCY 1 cut(s) 116
BstYI RGATCY 1 cut(s) 116
BsuRI GGCC 2 cut(s) 194, 251
BtgI CCRYGG 2 cut(s) 195, 270
BtsCI GGATG 2 cut(s) 205, 266
Cac8I GCNNGC 4 cut(s) 7, 34, 277, 289
Cfr13I GGNCC 2 cut(s) 192, 212
CviAII CATG 4 cut(s) 121, 230, 271, 288
DdeI CTNAG 3 cut(s) 16, 246, 303
DpnI GATC 4 cut(s) 28, 118, 134, 139
DpnII GATC 4 cut(s) 26, 116, 132, 137
DraIII CACNNNGTG 1 cut(s) 104
Eam1104I CTCTTC 1 cut(s) 336
EarI CTCTTC 1 cut(s) 336
Eco130I CCWWGG 1 cut(s) 270
Eco147I AGGCCT 1 cut(s) 251
Eco24I GRGCYC 1 cut(s) 55
Eco47I GGWCC 1 cut(s) 212
EcoO109I RGGNCCY 1 cut(s) 212
EcoRII CCWGG 1 cut(s) 150
EcoT14I CCWWGG 1 cut(s) 270
EcoT22I ATGCAT 1 cut(s) 289
EcoT38I GRGCYC 1 cut(s) 55
ErhI CCWWGG 1 cut(s) 270
FaeI CATG 4 cut(s) 124, 233, 274, 291
FaiI YATR 6 cut(s) 122, 146, 231, 272, 289, 322
FatI CATG 4 cut(s) 120, 229, 270, 287
FauI CCCGC 1 cut(s) 41
Fnu4HI GCNGC 1 cut(s) 258
FokI GGATG 2 cut(s) 212, 253
FriOI GRGCYC 1 cut(s) 55
Fsp4HI GCNGC 1 cut(s) 258
FspBI CTAG 1 cut(s) 276
GluI GCNGC 1 cut(s) 258
GsaI CCCAGC 1 cut(s) 41
GsuI CTGGAG 2 cut(s) 39, 246
HaeIII GGCC 2 cut(s) 194, 251
HapII CCGG 1 cut(s) 89
Hin1II CATG 4 cut(s) 124, 233, 274, 291
HpaII CCGG 1 cut(s) 89
Hpy188I TCNGA 3 cut(s) 137, 247, 283
Hpy188III TCNNGA 1 cut(s) 18
Hpy99I CGWCG 1 cut(s) 51
HpyCH4III ACNGT 2 cut(s) 238, 366
HpyCH4V TGCA 6 cut(s) 98, 185, 287, 291, 324, 361
HpyF10VI GCNNNNNNNGC 7 cut(s) 38, 191, 200, 248, 257, 263, 272
HpyF3I CTNAG 3 cut(s) 16, 246, 303
Hsp92II CATG 4 cut(s) 124, 233, 274, 291
Kzo9I GATC 4 cut(s) 26, 116, 132, 137
LmnI GCTCC 5 cut(s) 46, 58, 85, 97, 265
Lsp1109I GCAGC 1 cut(s) 244
LweI GCATC 3 cut(s) 190, 274, 275
MaeI CTAG 1 cut(s) 276
MalI GATC 4 cut(s) 28, 118, 134, 139
MboI GATC 4 cut(s) 26, 116, 132, 137
MboII GAAGA 1 cut(s) 323
MflI RGATCY 1 cut(s) 116
MhlI GDGCHC 1 cut(s) 55
MnlI CCTC 9 cut(s) 14, 54, 93, 122, 161, 225, 241, 253, 262
Mph1103I ATGCAT 1 cut(s) 289
MspI CCGG 1 cut(s) 89
MspR9I CCNGG 2 cut(s) 89, 152
MvaI CCWGG 1 cut(s) 152
MwoI GCNNNNNNNGC 7 cut(s) 38, 191, 200, 248, 257, 263, 272
NciI CCSGG 1 cut(s) 89
NcoI CCATGG 1 cut(s) 270
NdeII GATC 4 cut(s) 26, 116, 132, 137
NheI GCTAGC 1 cut(s) 275
NlaIII CATG 4 cut(s) 124, 233, 274, 291
NlaIV GGNNCC 5 cut(s) 54, 81, 93, 118, 213
NsiI ATGCAT 1 cut(s) 289
NspI RCATGY 1 cut(s) 291
PaeI GCATGC 1 cut(s) 291
PasI CCCWGGG 1 cut(s) 151
PceI AGGCCT 1 cut(s) 251
PflMI CCANNNNNTGG 1 cut(s) 157
PkrI GCNGC 1 cut(s) 259
PpuMI RGGWCCY 1 cut(s) 212
Psp5II RGGWCCY 1 cut(s) 212
Psp6I CCWGG 1 cut(s) 150
PspFI CCCAGC 1 cut(s) 37
PspGI CCWGG 1 cut(s) 150
PspN4I GGNNCC 5 cut(s) 54, 81, 93, 118, 213
PspPI GGNCC 2 cut(s) 192, 212
PspPPI RGGWCCY 1 cut(s) 212
PsuI RGATCY 1 cut(s) 116
SatI GCNGC 1 cut(s) 258
Sau3AI GATC 4 cut(s) 26, 116, 132, 137
Sau96I GGNCC 2 cut(s) 192, 212
ScrFI CCNGG 2 cut(s) 89, 152
SduI GDGCHC 1 cut(s) 55
SetI ASST 5 cut(s) 17, 25, 43, 172, 281
SfaNI GCATC 3 cut(s) 190, 274, 275
SfcI CTRYAG 1 cut(s) 365
SinI GGWCC 1 cut(s) 212
SphI GCATGC 1 cut(s) 291
SseBI AGGCCT 1 cut(s) 251
SsiI CCGC 2 cut(s) 34, 111
SspMI CTAG 1 cut(s) 276
StuI AGGCCT 1 cut(s) 251
StyD4I CCNGG 2 cut(s) 87, 150
StyI CCWWGG 1 cut(s) 270
TaaI ACNGT 2 cut(s) 238, 366
TaqI TCGA 1 cut(s) 25
TseI GCWGC 1 cut(s) 257
TspDTI ATGAA 1 cut(s) 246
Van91I CCANNNNNTGG 1 cut(s) 157
VpaK11BI GGWCC 1 cut(s) 212
XceI RCATGY 1 cut(s) 291
XspI CTAG 1 cut(s) 276
Zsp2I ATGCAT 1 cut(s) 289
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.