Rw2G049420

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr2
OG0012243
Physical Location & Seq
Reverse (-)
77040079 .. 77040279
201 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw2G049420.1

Sequence Viewer

Length: 201 bp
ATGGAGGCCAGTAACGAAGAGAAGAAGCCCACAAAGCCTCCATCCGTTCTGGGTAAAGATGACAGCAAACCTGTGCTTCAAGACCCAATTCTGACGTCGGACCCAATTGAGACAGAGGAAGGCGTGCTGAGATTGCCTCCATCTTCCCTACTCCCTGACTATCAAGAAACGCTTAACACCAACTCTTCTTTTACTAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.21

Weight (kDa)

4.31

Isoelectric Point (pI)

65.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 98
AcyI GRCGYC 1 cut(s) 95
AgsI TTSAA 1 cut(s) 80
AhlI ACTAGT 1 cut(s) 194
Alw26I GTCTC 1 cut(s) 104
AoxI GGCC 1 cut(s) 6
AspS9I GGNCC 1 cut(s) 100
AvaII GGWCC 1 cut(s) 100
BccI CCATC 2 cut(s) 49, 148
BcoDI GTCTC 1 cut(s) 104
BcuI ACTAGT 1 cut(s) 194
BfaI CTAG 1 cut(s) 195
Bme18I GGWCC 1 cut(s) 100
BmgT120I GGNCC 1 cut(s) 100
BmiI GGNNCC 1 cut(s) 102
BplI GAGNNNNNCTC 2 cut(s) 121, 153
BsaHI GRCGYC 1 cut(s) 95
BsaXI ACNNNNNCTCC 2 cut(s) 22, 52
Bse1I ACTGG 1 cut(s) 9
BseGI GGATG 1 cut(s) 41
BseMII CTCAG 1 cut(s) 119
BseNI ACTGG 1 cut(s) 9
BshFI GGCC 1 cut(s) 8
BsmAI GTCTC 1 cut(s) 104
BsnI GGCC 1 cut(s) 8
BspANI GGCC 1 cut(s) 8
BspCNI CTCAG 1 cut(s) 120
BspLI GGNNCC 1 cut(s) 102
BsrI ACTGG 1 cut(s) 9
BssNI GRCGYC 1 cut(s) 95
Bst6I CTCTTC 2 cut(s) 12, 190
BstACI GRCGYC 1 cut(s) 95
BstC8I GCNNGC 1 cut(s) 125
BstDEI CTNAG 1 cut(s) 128
BstF5I GGATG 1 cut(s) 41
BstMAI GTCTC 1 cut(s) 104
BstMWI GCNNNNNNNGC 2 cut(s) 34, 133
BsuRI GGCC 1 cut(s) 8
BtsCI GGATG 1 cut(s) 41
Cac8I GCNNGC 1 cut(s) 125
Cfr13I GGNCC 1 cut(s) 100
CviJI RGCY 3 cut(s) 8, 28, 37
CviKI_1 RGCY 3 cut(s) 8, 28, 37
DdeI CTNAG 1 cut(s) 128
Eam1104I CTCTTC 2 cut(s) 12, 190
EarI CTCTTC 2 cut(s) 12, 190
Eco47I GGWCC 1 cut(s) 100
FalI AAGNNNNNCTT 2 cut(s) 156, 188
FokI GGATG 1 cut(s) 28
FspBI CTAG 1 cut(s) 195
HaeIII GGCC 1 cut(s) 8
Hin1I GRCGYC 1 cut(s) 95
Hpy188I TCNGA 2 cut(s) 93, 100
Hpy188III TCNNGA 2 cut(s) 80, 164
Hpy99I CGWCG 1 cut(s) 100
HpyAV CCTTC 1 cut(s) 113
HpyCH4IV ACGT 1 cut(s) 95
HpyF10VI GCNNNNNNNGC 2 cut(s) 34, 133
HpyF3I CTNAG 1 cut(s) 128
HpySE526I ACGT 1 cut(s) 95
Hsp92I GRCGYC 1 cut(s) 95
LpnPI CCDG 4 cut(s) 22, 35, 84, 168
MaeI CTAG 1 cut(s) 195
MaeII ACGT 1 cut(s) 95
MaeIII GTNAC 1 cut(s) 11
MboII GAAGA 4 cut(s) 29, 34, 135, 177
MfeI CAATTG 1 cut(s) 105
MluCI AATT 2 cut(s) 87, 105
MmeI TCCRAC 1 cut(s) 78
MnlI CCTC 3 cut(s) 48, 109, 147
MseI TTAA 1 cut(s) 174
MunI CAATTG 1 cut(s) 105
MwoI GCNNNNNNNGC 2 cut(s) 34, 133
NlaIV GGNNCC 1 cut(s) 102
PspN4I GGNNCC 1 cut(s) 102
PspPI GGNCC 1 cut(s) 100
SaqAI TTAA 1 cut(s) 174
Sau96I GGNCC 1 cut(s) 100
SetI ASST 2 cut(s) 73, 98
SgeI CNNG 7 cut(s) 21, 62, 83, 92, 136, 167, 176
SinI GGWCC 1 cut(s) 100
SpeI ACTAGT 1 cut(s) 194
Sse9I AATT 2 cut(s) 87, 105
SspMI CTAG 1 cut(s) 195
TaiI ACGT 1 cut(s) 98
TasI AATT 2 cut(s) 87, 105
Tru1I TTAA 1 cut(s) 174
Tru9I TTAA 1 cut(s) 174
TspGWI ACGGA 1 cut(s) 34
VpaK11BI GGWCC 1 cut(s) 100
XspI CTAG 1 cut(s) 195
ZraI GACGTC 1 cut(s) 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.