AT1G20280

sequence-specific DNA binding

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
Physical Location & Seq
Forward (+)
7023682 .. 7024439
758 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G20280.1

Sequence Viewer

Length: 171 bp
ATGGAATCCAATTCATTTTTCTTCAATCCATCTGCTTCACATGGCAACATCATGTTCTTCTTTAGGAATCTCAATCCCGTTGTCCAAGCTGTTCGTTTGAATTCACGAAGGGGGAGGAACAAGATCGATGATGAACAAGGAGGAAACATCAAAGCGAAGGCCCTTCTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

6.36

Weight (kDa)

10.88

Isoelectric Point (pI)

53.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 100
AgsI TTSAA 2 cut(s) 25, 100
AjuI GAANNNNNNNTTGG 1 cut(s) 34
AluBI AGCT 1 cut(s) 89
AluI AGCT 1 cut(s) 89
AoxI GGCC 1 cut(s) 159
ApoI RAATTY 1 cut(s) 100
AspS9I GGNCC 1 cut(s) 160
BccI CCATC 1 cut(s) 37
BmgT120I GGNCC 1 cut(s) 160
Bsa29I ATCGAT 1 cut(s) 126
BseCI ATCGAT 1 cut(s) 126
BshFI GGCC 1 cut(s) 161
BshVI ATCGAT 1 cut(s) 126
BsnI GGCC 1 cut(s) 161
Bsp143I GATC 1 cut(s) 123
BspANI GGCC 1 cut(s) 161
BspDI ATCGAT 1 cut(s) 126
BssMI GATC 1 cut(s) 123
BstKTI GATC 1 cut(s) 126
BstMBI GATC 1 cut(s) 123
Bsu15I ATCGAT 1 cut(s) 126
BsuRI GGCC 1 cut(s) 161
BsuTUI ATCGAT 1 cut(s) 126
Cfr13I GGNCC 1 cut(s) 160
ClaI ATCGAT 1 cut(s) 126
CviAII CATG 2 cut(s) 41, 52
CviJI RGCY 2 cut(s) 89, 161
CviKI_1 RGCY 2 cut(s) 89, 161
DpnI GATC 1 cut(s) 125
DpnII GATC 1 cut(s) 123
EcoO109I RGGNCCY 1 cut(s) 160
EcoRI GAATTC 1 cut(s) 100
FaeI CATG 2 cut(s) 44, 55
FaiI YATR 2 cut(s) 42, 53
FatI CATG 2 cut(s) 40, 51
HaeIII GGCC 1 cut(s) 161
Hin1II CATG 2 cut(s) 44, 55
HinfI GANTC 2 cut(s) 5, 67
Hpy188III TCNNGA 1 cut(s) 105
HpyAV CCTTC 2 cut(s) 102, 151
Hsp92II CATG 2 cut(s) 44, 55
Kzo9I GATC 1 cut(s) 123
MalI GATC 1 cut(s) 125
MboI GATC 1 cut(s) 123
MboII GAAGA 2 cut(s) 13, 49
MluCI AATT 2 cut(s) 10, 100
MnlI CCTC 2 cut(s) 108, 134
NdeII GATC 1 cut(s) 123
NlaIII CATG 2 cut(s) 44, 55
PfeI GAWTC 2 cut(s) 5, 67
PspPI GGNCC 1 cut(s) 160
Sau3AI GATC 1 cut(s) 123
Sau96I GGNCC 1 cut(s) 160
SetI ASST 1 cut(s) 91
SgeI CNNG 7 cut(s) 53, 64, 89, 98, 117, 133, 149
Sse9I AATT 2 cut(s) 10, 100
TaqI TCGA 1 cut(s) 126
TasI AATT 2 cut(s) 10, 100
TfiI GAWTC 2 cut(s) 5, 67
TspDTI ATGAA 1 cut(s) 147
XapI RAATTY 1 cut(s) 100
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.