Rmu_sc0007623.1_g000001

Homeobox-leucine zipper protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007623.1
Physical Location & Seq
Forward (+)
1 .. 1251
1251 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007623.1_g000001.1.cds

Sequence Viewer

Length: 477 bp
gtggtcgccataactgagaaacttgaagctaaagatcaggaggaaaaaggagcagcatttgcaggtgatcatcatcatcatgatgagaagcgtctccctggtcatcttcttccaggtgagaaagagatgatcacggatgtcaatgttccaatgagcctccagttcgatgtgaaggttgaggatcgcctgagctccgggagcggtgcttccgccgtggtggacgaggaaggccctcagcacgtggacagcggtgactcgtatttcccaagtagctctgacgtccacaattatcctcctcctcatcctccacatgatcatcaccactgcatggggctagtaggtggggtccactcggaggacgatggcagcgatgacggtcggagttacttctctgatgtgtttgccgccgccgccgcagagcagcagcagcagcagccggaggagggcgtgtcgatgggctggtgggtgtggtcctaa

Protein Analysis

158

Amino Acids

17.23

Weight (kDa)

4.66

Isoelectric Point (pI)

56.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 53
AatII GACGTC 1 cut(s) 282
Acc36I ACCTGC 1 cut(s) 53
AccB7I CCANNNNNTGG 1 cut(s) 328
AccBSI CCGCTC 1 cut(s) 201
AciI CCGC 7 cut(s) 201, 210, 249, 405, 408, 411, 414
AclWI GGATC 1 cut(s) 189
AcvI CACGTG 1 cut(s) 241
AcyI GRCGYC 1 cut(s) 279
AfiI CCNNNNNNNGG 3 cut(s) 328, 355, 443
AgsI TTSAA 1 cut(s) 26
AjnI CCWGG 2 cut(s) 97, 112
AluBI AGCT 3 cut(s) 29, 192, 273
AluI AGCT 3 cut(s) 29, 192, 273
Alw21I GWGCWC 1 cut(s) 194
Alw26I GTCTC 1 cut(s) 98
AlwI GGATC 1 cut(s) 189
AoxI GGCC 1 cut(s) 229
ApeKI GCWGC 7 cut(s) 53, 366, 421, 424, 427, 430, 433
AspS9I GGNCC 3 cut(s) 230, 346, 471
AsuC2I CCSGG 1 cut(s) 196
AsuHPI GGTGA 4 cut(s) 77, 128, 263, 311
AvaII GGWCC 2 cut(s) 346, 471
BanII GRGCYC 1 cut(s) 194
BbrPI CACGTG 1 cut(s) 241
Bbv12I GWGCWC 1 cut(s) 194
BbvCI CCTCAGC 1 cut(s) 234
BbvI GCAGC 7 cut(s) 65, 378, 433, 436, 439, 442, 445
BccI CCATC 2 cut(s) 356, 448
BceAI ACGGC 1 cut(s) 197
BciT130I CCWGG 2 cut(s) 99, 114
BclI TGATCA 3 cut(s) 67, 129, 313
BcnI CCSGG 1 cut(s) 196
BcoDI GTCTC 1 cut(s) 98
BfaI CTAG 1 cut(s) 335
BfuAI ACCTGC 1 cut(s) 53
Bme1390I CCNGG 3 cut(s) 99, 114, 196
Bme18I GGWCC 2 cut(s) 346, 471
BmgT120I GGNCC 3 cut(s) 230, 346, 471
BmiI GGNNCC 1 cut(s) 347
BmrFI CCNGG 3 cut(s) 99, 114, 196
BpmI CTGGAG 1 cut(s) 143
Bpu10I CCTNAGC 2 cut(s) 188, 234
BpuMI CCSGG 1 cut(s) 196
BsaAI YACGTR 1 cut(s) 241
BsaBI GATNNNNATC 1 cut(s) 72
BsaHI GRCGYC 1 cut(s) 279
BsaJI CCNNGG 2 cut(s) 97, 213
BsaXI ACNNNNNCTCC 2 cut(s) 434, 464
Bsc4I CCNNNNNNNGG 3 cut(s) 328, 355, 443
Bse1I ACTGG 1 cut(s) 160
Bse8I GATNNNNATC 1 cut(s) 72
BseBI CCWGG 2 cut(s) 99, 114
BseDI CCNNGG 2 cut(s) 97, 213
BseGI GGATG 2 cut(s) 142, 301
BseJI GATNNNNATC 1 cut(s) 72
BseLI CCNNNNNNNGG 3 cut(s) 328, 355, 443
BseMII CTCAG 3 cut(s) 6, 179, 248
BseNI ACTGG 1 cut(s) 160
BseRI GAGGAG 3 cut(s) 285, 288, 455
BseXI GCAGC 7 cut(s) 65, 378, 433, 436, 439, 442, 445
Bsh1285I CGRYCG 1 cut(s) 379
BshFI GGCC 1 cut(s) 231
BsiEI CGRYCG 1 cut(s) 379
BsiHKAI GWGCWC 1 cut(s) 194
BsiSI CCGG 2 cut(s) 195, 437
BslI CCNNNNNNNGG 3 cut(s) 328, 355, 443
BsmAI GTCTC 1 cut(s) 98
BsmBI CGTCTC 1 cut(s) 98
BsnI GGCC 1 cut(s) 231
Bsp1286I GDGCHC 1 cut(s) 194
Bsp143I GATC 5 cut(s) 34, 67, 129, 181, 313
BspACI CCGC 7 cut(s) 201, 210, 249, 405, 408, 411, 414
BspANI GGCC 1 cut(s) 231
BspCNI CTCAG 3 cut(s) 7, 180, 247
BspHI TCATGA 1 cut(s) 79
BspLI GGNNCC 1 cut(s) 347
BspMI ACCTGC 1 cut(s) 53
BspPI GGATC 1 cut(s) 189
BsrBI CCGCTC 1 cut(s) 201
BsrI ACTGG 1 cut(s) 160
BssECI CCNNGG 2 cut(s) 97, 213
BssMI GATC 5 cut(s) 34, 67, 129, 181, 313
BssNI GRCGYC 1 cut(s) 279
Bst2UI CCWGG 2 cut(s) 99, 114
Bst4CI ACNGT 1 cut(s) 377
BstACI GRCGYC 1 cut(s) 279
BstAPI GCANNNNNTGC 1 cut(s) 59
BstBAI YACGTR 1 cut(s) 241
BstDEI CTNAG 3 cut(s) 15, 188, 234
BstDSI CCRYGG 1 cut(s) 213
BstF5I GGATG 2 cut(s) 142, 301
BstKTI GATC 5 cut(s) 37, 70, 132, 184, 316
BstMAI GTCTC 1 cut(s) 98
BstMBI GATC 5 cut(s) 34, 67, 129, 181, 313
BstMCI CGRYCG 1 cut(s) 379
BstMWI GCNNNNNNNGC 7 cut(s) 59, 198, 410, 413, 427, 430, 433
BstNI CCWGG 2 cut(s) 99, 114
BstSCI CCNGG 3 cut(s) 97, 112, 194
BstV1I GCAGC 7 cut(s) 65, 378, 433, 436, 439, 442, 445
BsuRI GGCC 1 cut(s) 231
BtgI CCRYGG 1 cut(s) 213
BtgZI GCGATG 1 cut(s) 384
BtsCI GGATG 2 cut(s) 142, 301
BtsI GCAGTG 1 cut(s) 322
BtsIMutI CAGTG 1 cut(s) 322
BveI ACCTGC 1 cut(s) 53
CciI TCATGA 1 cut(s) 79
Cfr13I GGNCC 3 cut(s) 230, 346, 471
CseI GACGC 1 cut(s) 80
CviAII CATG 3 cut(s) 80, 311, 328
CviJI RGCY 8 cut(s) 29, 156, 192, 231, 273, 334, 436, 459
CviKI_1 RGCY 8 cut(s) 29, 156, 192, 231, 273, 334, 436, 459
DdeI CTNAG 3 cut(s) 15, 188, 234
DpnI GATC 5 cut(s) 36, 69, 131, 183, 315
DpnII GATC 5 cut(s) 34, 67, 129, 181, 313
EciI GGCGGA 1 cut(s) 199
Ecl136II GAGCTC 1 cut(s) 192
Eco24I GRGCYC 1 cut(s) 194
Eco47I GGWCC 2 cut(s) 346, 471
Eco53kI GAGCTC 1 cut(s) 192
Eco72I CACGTG 1 cut(s) 241
EcoICRI GAGCTC 1 cut(s) 192
EcoO109I RGGNCCY 1 cut(s) 230
EcoRII CCWGG 2 cut(s) 97, 112
EcoT38I GRGCYC 1 cut(s) 194
Esp3I CGTCTC 1 cut(s) 98
FaeI CATG 3 cut(s) 83, 314, 331
FaiI YATR 4 cut(s) 11, 81, 312, 329
FatI CATG 3 cut(s) 79, 310, 327
FbaI TGATCA 3 cut(s) 67, 129, 313
FokI GGATG 2 cut(s) 149, 288
FriOI GRGCYC 1 cut(s) 194
FspBI CTAG 1 cut(s) 335
GsuI CTGGAG 1 cut(s) 143
HaeIII GGCC 1 cut(s) 231
HapII CCGG 2 cut(s) 195, 437
HgaI GACGC 1 cut(s) 80
Hin1I GRCGYC 1 cut(s) 279
Hin1II CATG 3 cut(s) 83, 314, 331
HinfI GANTC 1 cut(s) 254
HpaII CCGG 2 cut(s) 195, 437
HphI GGTGA 4 cut(s) 77, 128, 263, 311
Hpy166II GTNNAC 4 cut(s) 220, 244, 283, 349
Hpy188I TCNGA 4 cut(s) 277, 355, 381, 394
Hpy188III TCNNGA 2 cut(s) 38, 80
Hpy8I GTNNAC 4 cut(s) 220, 244, 283, 349
HpyAV CCTTC 2 cut(s) 166, 221
HpyCH4III ACNGT 1 cut(s) 377
HpyCH4IV ACGT 2 cut(s) 240, 279
HpyCH4V TGCA 2 cut(s) 62, 327
HpyF10VI GCNNNNNNNGC 7 cut(s) 59, 198, 410, 413, 427, 430, 433
HpyF3I CTNAG 3 cut(s) 15, 188, 234
HpySE526I ACGT 2 cut(s) 240, 279
Hsp92I GRCGYC 1 cut(s) 279
Hsp92II CATG 3 cut(s) 83, 314, 331
Ksp22I TGATCA 3 cut(s) 67, 129, 313
Kzo9I GATC 5 cut(s) 34, 67, 129, 181, 313
LmnI GCTCC 3 cut(s) 50, 197, 198
Lsp1109I GCAGC 7 cut(s) 65, 378, 433, 436, 439, 442, 445
MaeI CTAG 1 cut(s) 335
MaeII ACGT 2 cut(s) 240, 279
MaeIII GTNAC 2 cut(s) 251, 383
MalI GATC 5 cut(s) 36, 69, 131, 183, 315
MbiI CCGCTC 1 cut(s) 201
MboI GATC 5 cut(s) 34, 67, 129, 181, 313
MboII GAAGA 2 cut(s) 98, 101
MhlI GDGCHC 1 cut(s) 194
MluCI AATT 1 cut(s) 286
MlyI GAGTC 1 cut(s) 248
MmeI TCCRAC 1 cut(s) 359
MslI CAYNNNNRTG 2 cut(s) 78, 81
MspA1I CMGCKG 1 cut(s) 249
MspI CCGG 2 cut(s) 195, 437
MspR9I CCNGG 3 cut(s) 99, 114, 196
MvaI CCWGG 2 cut(s) 99, 114
MwoI GCNNNNNNNGC 7 cut(s) 59, 198, 410, 413, 427, 430, 433
NciI CCSGG 1 cut(s) 196
NdeII GATC 5 cut(s) 34, 67, 129, 181, 313
NlaIII CATG 3 cut(s) 83, 314, 331
NlaIV GGNNCC 1 cut(s) 347
NmuCI GTSAC 1 cut(s) 251
PagI TCATGA 1 cut(s) 79
PaqCI CACCTGC 1 cut(s) 53
PcsI WCGNNNNNNNCGW 1 cut(s) 366
PflMI CCANNNNNTGG 1 cut(s) 328
PfoI TCCNGGA 1 cut(s) 194
PleI GAGTC 1 cut(s) 248
PmaCI CACGTG 1 cut(s) 241
PmlI CACGTG 1 cut(s) 241
PpsI GAGTC 1 cut(s) 248
Ppu21I YACGTR 1 cut(s) 241
Psp124BI GAGCTC 1 cut(s) 194
Psp6I CCWGG 2 cut(s) 97, 112
PspCI CACGTG 1 cut(s) 241
PspGI CCWGG 2 cut(s) 97, 112
PspN4I GGNNCC 1 cut(s) 347
PspPI GGNCC 3 cut(s) 230, 346, 471
RseI CAYNNNNRTG 2 cut(s) 78, 81
SacI GAGCTC 1 cut(s) 194
Sau3AI GATC 5 cut(s) 34, 67, 129, 181, 313
Sau96I GGNCC 3 cut(s) 230, 346, 471
SchI GAGTC 1 cut(s) 248
ScrFI CCNGG 3 cut(s) 99, 114, 196
SduI GDGCHC 1 cut(s) 194
SetI ASST 9 cut(s) 31, 67, 118, 177, 194, 243, 275, 282, 343
SinI GGWCC 2 cut(s) 346, 471
SmiMI CAYNNNNRTG 2 cut(s) 78, 81
Sse9I AATT 1 cut(s) 286
SsiI CCGC 7 cut(s) 201, 210, 249, 405, 408, 411, 414
SspMI CTAG 1 cut(s) 335
SstI GAGCTC 1 cut(s) 194
StyD4I CCNGG 3 cut(s) 97, 112, 194
TaaI ACNGT 1 cut(s) 377
TaiI ACGT 2 cut(s) 243, 282
TaqI TCGA 2 cut(s) 165, 452
TasI AATT 1 cut(s) 286
TauI GCSGC 4 cut(s) 407, 410, 413, 416
TscAI CASTG 1 cut(s) 329
TseFI GTSAC 1 cut(s) 251
TseI GCWGC 7 cut(s) 53, 366, 421, 424, 427, 430, 433
Tsp45I GTSAC 1 cut(s) 251
TspGWI ACGGA 1 cut(s) 149
TspRI CASTG 1 cut(s) 329
Van91I CCANNNNNTGG 1 cut(s) 328
VpaK11BI GGWCC 2 cut(s) 346, 471
XspI CTAG 1 cut(s) 335
ZraI GACGTC 1 cut(s) 280
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.