AT1G61200

sequence-specific DNA binding

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
OG0008725
Physical Location & Seq
Reverse (-)
22562811 .. 22563577
767 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G61200.1

Sequence Viewer

Length: 216 bp
ATGGAATCCAATTCGTTTTTCTTCAATCCATCTGCTTCACATGGCAACAACATGTTCTTCTTTAGGAATCTCAATCCCGTTGTCCAAGGAGGAGGAACAAGATCGATGATGAACAAGGAGGAAACATCAAAGCGAAGGCCTTTCTTTAGCTCCCTTGAGGATCCCTACGACGATGACTATTACGACGACCACTTGCTGAAAATAAGAGGCTGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

8.29

Weight (kDa)

5.51

Isoelectric Point (pI)

60.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 155, 168
AflIII ACRYGT 1 cut(s) 51
AgsI TTSAA 1 cut(s) 25
AjuI GAANNNNNNNTTGG 1 cut(s) 34
AluBI AGCT 1 cut(s) 150
AluI AGCT 1 cut(s) 150
AlwI GGATC 2 cut(s) 155, 168
AoxI GGCC 1 cut(s) 137
BamHI GGATCC 1 cut(s) 160
BccI CCATC 1 cut(s) 37
BmiI GGNNCC 1 cut(s) 162
BpuEI CTTGAG 1 cut(s) 176
Bsa29I ATCGAT 1 cut(s) 104
BsaJI CCNNGG 1 cut(s) 85
BseCI ATCGAT 1 cut(s) 104
BseDI CCNNGG 1 cut(s) 85
BseRI GAGGAG 1 cut(s) 105
BshFI GGCC 1 cut(s) 139
BshVI ATCGAT 1 cut(s) 104
BsnI GGCC 1 cut(s) 139
Bsp143I GATC 2 cut(s) 101, 160
BspANI GGCC 1 cut(s) 139
BspDI ATCGAT 1 cut(s) 104
BspLI GGNNCC 1 cut(s) 162
BspPI GGATC 2 cut(s) 155, 168
BssECI CCNNGG 1 cut(s) 85
BssMI GATC 2 cut(s) 101, 160
BssT1I CCWWGG 1 cut(s) 85
BstKTI GATC 2 cut(s) 104, 163
BstMBI GATC 2 cut(s) 101, 160
BstNSI RCATGY 1 cut(s) 55
BstX2I RGATCY 1 cut(s) 160
BstYI RGATCY 1 cut(s) 160
Bsu15I ATCGAT 1 cut(s) 104
BsuRI GGCC 1 cut(s) 139
BsuTUI ATCGAT 1 cut(s) 104
ClaI ATCGAT 1 cut(s) 104
CviAII CATG 2 cut(s) 41, 52
CviJI RGCY 3 cut(s) 139, 150, 210
CviKI_1 RGCY 3 cut(s) 139, 150, 210
DpnI GATC 2 cut(s) 103, 162
DpnII GATC 2 cut(s) 101, 160
Eco130I CCWWGG 1 cut(s) 85
Eco147I AGGCCT 1 cut(s) 139
EcoT14I CCWWGG 1 cut(s) 85
ErhI CCWWGG 1 cut(s) 85
FaeI CATG 2 cut(s) 44, 55
FaiI YATR 2 cut(s) 42, 53
FatI CATG 2 cut(s) 40, 51
HaeIII GGCC 1 cut(s) 139
Hin1II CATG 2 cut(s) 44, 55
HinfI GANTC 2 cut(s) 5, 67
Hpy99I CGWCG 2 cut(s) 173, 188
HpyAV CCTTC 1 cut(s) 129
Hsp92II CATG 2 cut(s) 44, 55
Kzo9I GATC 2 cut(s) 101, 160
LmnI GCTCC 1 cut(s) 155
MalI GATC 2 cut(s) 103, 162
MboI GATC 2 cut(s) 101, 160
MboII GAAGA 2 cut(s) 13, 49
MflI RGATCY 1 cut(s) 160
MluCI AATT 1 cut(s) 10
MnlI CCTC 5 cut(s) 83, 86, 112, 151, 200
NdeII GATC 2 cut(s) 101, 160
NlaIII CATG 2 cut(s) 44, 55
NlaIV GGNNCC 1 cut(s) 162
NspI RCATGY 1 cut(s) 55
PceI AGGCCT 1 cut(s) 139
PciI ACATGT 1 cut(s) 51
PfeI GAWTC 2 cut(s) 5, 67
PscI ACATGT 1 cut(s) 51
PspN4I GGNNCC 1 cut(s) 162
PsuI RGATCY 1 cut(s) 160
Sau3AI GATC 2 cut(s) 101, 160
SetI ASST 1 cut(s) 152
SgeI CNNG 8 cut(s) 53, 64, 89, 98, 111, 127, 167, 205
SmlI CTYRAG 1 cut(s) 155
SmoI CTYRAG 1 cut(s) 155
Sse9I AATT 1 cut(s) 10
SseBI AGGCCT 1 cut(s) 139
StuI AGGCCT 1 cut(s) 139
StyI CCWWGG 1 cut(s) 85
TaqI TCGA 1 cut(s) 104
TasI AATT 1 cut(s) 10
TfiI GAWTC 2 cut(s) 5, 67
TspDTI ATGAA 1 cut(s) 125
XceI RCATGY 1 cut(s) 55
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.