AT3G09950

BEST Arabidopsis thaliana protein match is

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
OG0003727
Physical Location & Seq
Reverse (-)
3060090 .. 3060720
631 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G09950.1

Sequence Viewer

Length: 279 bp
ATGGGGAAGGGGGGTTGGCTTCTTAACTTTCTGAACCATGCCAAAAATCAAGAAAGTGTGGAGAATCTTGACAAAAACGGTGCCGTAAAGGCCCCAAGCAGTGGGTTTAAGATGCCGTTGCATTACCCAAGATACACAAAGGAGGATTATGAAGAGATGGAAGAGTGGAGATTGGATTTGCTTCTCTCGGAATACGGACTTCTTGCCTTCCATGACAATACTCTCCATGAGAAGCGAGCTTTTGCAATCGACACTTTTATATGGCCTCATCACCCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

92

Amino Acids

10.79

Weight (kDa)

5.81

Isoelectric Point (pI)

36.45

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF7722 PF24847 42 - 89 2.6e-23 Domain of unknown function (DUF7722)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 80
AccB7I CCANNNNNTGG 1 cut(s) 101
AfiI CCNNNNNNNGG 1 cut(s) 101
AluBI AGCT 1 cut(s) 239
AluI AGCT 1 cut(s) 239
AoxI GGCC 2 cut(s) 90, 263
AspS9I GGNCC 1 cut(s) 91
AsuHPI GGTGA 1 cut(s) 263
BanI GGYRCC 1 cut(s) 80
BccI CCATC 1 cut(s) 151
BceAI ACGGC 2 cut(s) 68, 100
BglI GCCNNNNNGGC 1 cut(s) 89
BmgT120I GGNCC 1 cut(s) 91
BmiI GGNNCC 2 cut(s) 82, 93
BmsI GCATC 1 cut(s) 102
Bsc4I CCNNNNNNNGG 1 cut(s) 101
BseLI CCNNNNNNNGG 1 cut(s) 101
BshFI GGCC 2 cut(s) 92, 265
BshNI GGYRCC 1 cut(s) 80
BslI CCNNNNNNNGG 1 cut(s) 101
BsnI GGCC 2 cut(s) 92, 265
BspANI GGCC 2 cut(s) 92, 265
BspLI GGNNCC 2 cut(s) 82, 93
BspT107I GGYRCC 1 cut(s) 80
Bst4CI ACNGT 1 cut(s) 80
Bst6I CTCTTC 2 cut(s) 147, 156
BstC8I GCNNGC 1 cut(s) 237
BstMWI GCNNNNNNNGC 1 cut(s) 89
BsuRI GGCC 2 cut(s) 92, 265
BtsI GCAGTG 1 cut(s) 106
BtsIMutI CAGTG 1 cut(s) 106
Cac8I GCNNGC 1 cut(s) 237
Cfr13I GGNCC 1 cut(s) 91
CviAII CATG 3 cut(s) 38, 212, 227
CviJI RGCY 4 cut(s) 19, 92, 239, 265
CviKI_1 RGCY 4 cut(s) 19, 92, 239, 265
Eam1104I CTCTTC 2 cut(s) 147, 156
EarI CTCTTC 2 cut(s) 147, 156
EcoO109I RGGNCCY 1 cut(s) 91
FaeI CATG 3 cut(s) 41, 215, 230
FaiI YATR 7 cut(s) 39, 150, 213, 228, 260, 262, 277
FatI CATG 3 cut(s) 37, 211, 226
HaeIII GGCC 2 cut(s) 92, 265
Hin1II CATG 3 cut(s) 41, 215, 230
HinfI GANTC 1 cut(s) 64
HphI GGTGA 1 cut(s) 263
Hpy188I TCNGA 2 cut(s) 33, 190
Hpy188III TCNNGA 2 cut(s) 50, 68
HpyAV CCTTC 1 cut(s) 217
HpyCH4III ACNGT 1 cut(s) 80
HpyCH4V TGCA 2 cut(s) 121, 245
HpyF10VI GCNNNNNNNGC 1 cut(s) 89
Hsp92II CATG 3 cut(s) 41, 215, 230
LweI GCATC 1 cut(s) 102
MboII GAAGA 2 cut(s) 164, 173
MnlI CCTC 2 cut(s) 136, 276
MseI TTAA 2 cut(s) 24, 108
MwoI GCNNNNNNNGC 1 cut(s) 89
NlaIII CATG 3 cut(s) 41, 215, 230
NlaIV GGNNCC 2 cut(s) 82, 93
PfeI GAWTC 1 cut(s) 64
PflMI CCANNNNNTGG 1 cut(s) 101
PspN4I GGNNCC 2 cut(s) 82, 93
PspPI GGNCC 1 cut(s) 91
SaqAI TTAA 2 cut(s) 24, 108
Sau96I GGNCC 1 cut(s) 91
SetI ASST 1 cut(s) 241
SfaNI GCATC 1 cut(s) 102
TaaI ACNGT 1 cut(s) 80
TaqI TCGA 1 cut(s) 249
TfiI GAWTC 1 cut(s) 64
Tru1I TTAA 2 cut(s) 24, 108
Tru9I TTAA 2 cut(s) 24, 108
TscAI CASTG 1 cut(s) 106
TspDTI ATGAA 1 cut(s) 165
TspGWI ACGGA 1 cut(s) 210
TspRI CASTG 1 cut(s) 106
Van91I CCANNNNNTGG 1 cut(s) 101
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.