Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002709.1

Orthogroup ID

OG0003727

Physical Location & Seq

Genomic Coordinates Forward (+)

166143 .. 166427

Gene Structure 285 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002709.1_g000046.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 285 bp

atggagagccgaaagatgaatgcaagtaacttccagatgccccttcactacccaaggtacagcagaaaggactacgaggacatgcctgagtggaagctcgaccatcttctcggtcagtatgggttgtctgcgcacggcgacttggcttacaagagagacttcgccatgggtgccttcctctggcctgatcatcatcgccatgaaccaaacccttgtaataattcataccagaataataccatcaaggatgtttccagttctcttagagacaaaaagatcatgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

94

Amino Acids

11.17

Weight (kDa)

7.91

Isoelectric Point (pI)

37.53

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003727)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G09950
fragaria_vesca	FvH4_3g00510 FvH4_7g23090 FvH4_7g23130
prunus_persica	Prupe.2G240100_v2.0.a1 Prupe.2G240200_v2.0.a1 Prupe.4G006200_v2.0.a1
rosa_chinensis	RchiOBHm_Chr1g0367441 RchiOBHm_Chr1g0368351 RchiOBHm_Chr1g0368481 RchiOBHm_Chr5g0000691
rosa_laevigata	RLG00000027217 RLG00000030888
rosa_multiflora	Rmu_sc0000255.1_g000001 Rmu_sc0002709.1_g000046 Rmu_sc0006908.1_g000023 Rmu_sc0011992.1_g000008
rosa_roxburghii	Rroxscaffold_1G00075520 Rroxscaffold_4G00288510 Rroxscaffold_4G00288620
rosa_rugosa	Rorug01G0342000 Rorug04G0386100
rosa_samantha	Rh1AG348000 Rh1BG311000 Rh1BG312500 Rh1DG342800 Rh1DG344000 Rh5BG007500 Rh5CG006300 Rh5DG006200
rosa_wichuraiana	Rw0G002400 Rw1G030980 Rw1G031100 Rw5G000590

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	132
AccB1I	GGYRCC	1 cut(s)	170
AfaI	GTAC	1 cut(s)	59
AfiI	CCNNNNNNNGG	1 cut(s)	180
AluBI	AGCT	1 cut(s)	97
AluI	AGCT	1 cut(s)	97
Alw26I	GTCTC	2 cut(s)	150, 261
AoxI	GGCC	1 cut(s)	182
AspLEI	GCGC	1 cut(s)	133
BanI	GGYRCC	1 cut(s)	170
BccI	CCATC	2 cut(s)	111, 248
BceAI	ACGGC	1 cut(s)	151
BclI	TGATCA	1 cut(s)	187
BcoDI	GTCTC	2 cut(s)	150, 261
BmiI	GGNNCC	1 cut(s)	172
BmsI	GCATC	1 cut(s)	27
BsaBI	GATNNNNATC	1 cut(s)	192
BsaJI	CCNNGG	2 cut(s)	53, 165
Bsc4I	CCNNNNNNNGG	1 cut(s)	180
Bse1I	ACTGG	1 cut(s)	255
Bse8I	GATNNNNATC	1 cut(s)	192
BseDI	CCNNGG	2 cut(s)	53, 165
BseGI	GGATG	1 cut(s)	253
BseJI	GATNNNNATC	1 cut(s)	192
BseLI	CCNNNNNNNGG	1 cut(s)	180
BseMII	CTCAG	1 cut(s)	78
BseNI	ACTGG	1 cut(s)	255
BshFI	GGCC	1 cut(s)	184
BshNI	GGYRCC	1 cut(s)	170
BslI	CCNNNNNNNGG	1 cut(s)	180
BsmAI	GTCTC	2 cut(s)	150, 261
BsmI	GAATGC	1 cut(s)	25
BsnI	GGCC	1 cut(s)	184
Bsp143I	GATC	2 cut(s)	187, 276
Bsp19I	CCATGG	1 cut(s)	165
BspANI	GGCC	1 cut(s)	184
BspCNI	CTCAG	1 cut(s)	79
BspLI	GGNNCC	1 cut(s)	172
BspT107I	GGYRCC	1 cut(s)	170
BsrI	ACTGG	1 cut(s)	255
BssECI	CCNNGG	2 cut(s)	53, 165
BssMI	GATC	2 cut(s)	187, 276
BssT1I	CCWWGG	2 cut(s)	53, 165
BstDEI	CTNAG	2 cut(s)	87, 263
BstDSI	CCRYGG	1 cut(s)	165
BstF5I	GGATG	1 cut(s)	253
BstHHI	GCGC	1 cut(s)	133
BstKTI	GATC	2 cut(s)	190, 279
BstMAI	GTCTC	2 cut(s)	150, 261
BstMBI	GATC	2 cut(s)	187, 276
BstMWI	GCNNNNNNNGC	1 cut(s)	170
BstNSI	RCATGY	1 cut(s)	85
BsuRI	GGCC	1 cut(s)	184
BtgI	CCRYGG	1 cut(s)	165
BtgZI	GCGATG	1 cut(s)	179
BtsCI	GGATG	1 cut(s)	253
CfoI	GCGC	1 cut(s)	133
Csp6I	GTAC	1 cut(s)	58
CviAII	CATG	4 cut(s)	82, 166, 200, 280
CviJI	RGCY	4 cut(s)	9, 97, 146, 184
CviKI_1	RGCY	4 cut(s)	9, 97, 146, 184
CviQI	GTAC	1 cut(s)	58
DdeI	CTNAG	2 cut(s)	87, 263
DpnI	GATC	2 cut(s)	189, 278
DpnII	GATC	2 cut(s)	187, 276
Eco130I	CCWWGG	2 cut(s)	53, 165
EcoT14I	CCWWGG	2 cut(s)	53, 165
ErhI	CCWWGG	2 cut(s)	53, 165
FaeI	CATG	4 cut(s)	85, 169, 203, 283
FaiI	YATR	6 cut(s)	83, 120, 167, 201, 226, 281
FalI	AAGNNNNNCTT	2 cut(s)	143, 175
FatI	CATG	4 cut(s)	81, 165, 199, 279
FbaI	TGATCA	1 cut(s)	187
FokI	GGATG	1 cut(s)	260
FspI	TGCGCA	1 cut(s)	132
GlaI	GCGC	1 cut(s)	132
HaeIII	GGCC	1 cut(s)	184
HhaI	GCGC	1 cut(s)	133
Hin1II	CATG	4 cut(s)	85, 169, 203, 283
Hin6I	GCGC	1 cut(s)	131
HinP1I	GCGC	1 cut(s)	131
Hpy188III	TCNNGA	1 cut(s)	34
HpyAV	CCTTC	2 cut(s)	53, 184
HpyCH4V	TGCA	1 cut(s)	23
HpyF10VI	GCNNNNNNNGC	1 cut(s)	170
HpyF3I	CTNAG	2 cut(s)	87, 263
Hsp92II	CATG	4 cut(s)	85, 169, 203, 283
HspAI	GCGC	1 cut(s)	131
Ksp22I	TGATCA	1 cut(s)	187
Kzo9I	GATC	2 cut(s)	187, 276
LpnPI	CCDG	6 cut(s)	47, 99, 166, 198, 242, 268
LweI	GCATC	1 cut(s)	27
MaeIII	GTNAC	1 cut(s)	26
MalI	GATC	2 cut(s)	189, 278
MboI	GATC	2 cut(s)	187, 276
MboII	GAAGA	1 cut(s)	98
MluCI	AATT	1 cut(s)	220
MnlI	CCTC	2 cut(s)	70, 188
MslI	CAYNNNNRTG	1 cut(s)	198
Mva1269I	GAATGC	1 cut(s)	25
MwoI	GCNNNNNNNGC	1 cut(s)	170
NcoI	CCATGG	1 cut(s)	165
NdeII	GATC	2 cut(s)	187, 276
NlaIII	CATG	4 cut(s)	85, 169, 203, 283
NlaIV	GGNNCC	1 cut(s)	172
NsbI	TGCGCA	1 cut(s)	132
NspI	RCATGY	1 cut(s)	85
PctI	GAATGC	1 cut(s)	25
PspN4I	GGNNCC	1 cut(s)	172
RsaI	GTAC	1 cut(s)	59
RsaNI	GTAC	1 cut(s)	58
RseI	CAYNNNNRTG	1 cut(s)	198
Sau3AI	GATC	2 cut(s)	187, 276
SetI	ASST	2 cut(s)	59, 99
SfaNI	GCATC	1 cut(s)	27
SmiMI	CAYNNNNRTG	1 cut(s)	198
Sse9I	AATT	1 cut(s)	220
StyI	CCWWGG	2 cut(s)	53, 165
TaqI	TCGA	1 cut(s)	99
TaqII	GACCGA	1 cut(s)	101
TasI	AATT	1 cut(s)	220
TspDTI	ATGAA	3 cut(s)	32, 213, 216
XceI	RCATGY	1 cut(s)	85

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.