AT4G07455

CONTAINS InterPro DOMAIN s Phosphoglycerate mutase (InterPro IPR013078), PRIB5 (InterPro IPR012398)

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
4
Physical Location & Seq
Forward (+)
4311373 .. 4311961
589 bp
Loading structure...
UTR
Exon/CDS
Intron
AT4G07455.1

Sequence Viewer

Length: 264 bp
ATGAAAAGCTCTCAAACTTGGACAGGAGTGAGGACTACAATTACAACCTTTAAAGACGTAGATGTGTACGACGTGAAGTATTGTGCTTGTGACAAACTAAGAAGACAGATCTTGAGTAAAGATGTGTCTACTAAAGCTGGAGACTTTGAGAATTTTAAGAAGGCTAAAGAAAAGTTTATGTTCAACAAGAAAGTAGGAGTTTCTGAAAGTTTTAACGGTCTCTCTCATGAACTTGTTTTGATGTTATCTAGTAACTTAGTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

87

Amino Acids

9.92

Weight (kDa)

9.36

Isoelectric Point (pI)

29.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 128
AcsI RAATTY 1 cut(s) 151
AfaI GTAC 1 cut(s) 68
AgsI TTSAA 1 cut(s) 184
AjiI CACGTC 1 cut(s) 73
AluBI AGCT 2 cut(s) 9, 137
AluI AGCT 2 cut(s) 9, 137
Alw26I GTCTC 2 cut(s) 135, 224
ApoI RAATTY 1 cut(s) 151
BbsI GAAGAC 1 cut(s) 109
BcoDI GTCTC 2 cut(s) 135, 224
BfaI CTAG 1 cut(s) 249
BglII AGATCT 1 cut(s) 108
BmgBI CACGTC 1 cut(s) 73
BpiI GAAGAC 1 cut(s) 109
BpmI CTGGAG 1 cut(s) 159
BpuEI CTTGAG 1 cut(s) 133
BsaI GGTCTC 1 cut(s) 224
BsmAI GTCTC 2 cut(s) 135, 224
Bso31I GGTCTC 1 cut(s) 224
Bsp143I GATC 1 cut(s) 108
BspHI TCATGA 1 cut(s) 226
BspTNI GGTCTC 1 cut(s) 224
BssMI GATC 1 cut(s) 108
Bst4CI ACNGT 1 cut(s) 218
BstDEI CTNAG 2 cut(s) 98, 256
BstKTI GATC 1 cut(s) 111
BstMAI GTCTC 2 cut(s) 135, 224
BstMBI GATC 1 cut(s) 108
BstV2I GAAGAC 1 cut(s) 109
BstX2I RGATCY 1 cut(s) 108
BstYI RGATCY 1 cut(s) 108
BtrI CACGTC 1 cut(s) 73
CciI TCATGA 1 cut(s) 226
Csp6I GTAC 1 cut(s) 67
CviAII CATG 1 cut(s) 227
CviJI RGCY 3 cut(s) 9, 137, 164
CviKI_1 RGCY 3 cut(s) 9, 137, 164
CviQI GTAC 1 cut(s) 67
DdeI CTNAG 2 cut(s) 98, 256
DpnI GATC 1 cut(s) 110
DpnII GATC 1 cut(s) 108
DraI TTTAAA 1 cut(s) 52
Eco31I GGTCTC 1 cut(s) 224
FaeI CATG 1 cut(s) 230
FaiI YATR 3 cut(s) 179, 228, 262
FatI CATG 1 cut(s) 226
FblI GTMKAC 1 cut(s) 128
FspBI CTAG 1 cut(s) 249
FspEI CC 8 cut(s) 4, 9, 16, 61, 123, 146, 180, 201
GsuI CTGGAG 1 cut(s) 159
Hin1II CATG 1 cut(s) 230
Hpy166II GTNNAC 2 cut(s) 67, 129
Hpy188I TCNGA 1 cut(s) 205
Hpy188III TCNNGA 2 cut(s) 112, 227
Hpy8I GTNNAC 2 cut(s) 67, 129
Hpy99I CGWCG 1 cut(s) 74
HpyAV CCTTC 1 cut(s) 154
HpyCH4III ACNGT 1 cut(s) 218
HpyCH4IV ACGT 2 cut(s) 57, 72
HpyF3I CTNAG 2 cut(s) 98, 256
HpySE526I ACGT 2 cut(s) 57, 72
Hsp92II CATG 1 cut(s) 230
Kzo9I GATC 1 cut(s) 108
LpnPI CCDG 2 cut(s) 9, 123
MaeI CTAG 1 cut(s) 249
MaeII ACGT 2 cut(s) 57, 72
MaeIII GTNAC 2 cut(s) 89, 251
MalI GATC 1 cut(s) 110
MboI GATC 1 cut(s) 108
MboII GAAGA 1 cut(s) 114
MflI RGATCY 1 cut(s) 108
MluCI AATT 2 cut(s) 39, 151
MnlI CCTC 1 cut(s) 24
MseI TTAA 3 cut(s) 51, 156, 213
NdeII GATC 1 cut(s) 108
NlaIII CATG 1 cut(s) 230
NmuCI GTSAC 1 cut(s) 89
PagI TCATGA 1 cut(s) 226
PsuI RGATCY 1 cut(s) 108
RsaI GTAC 1 cut(s) 68
RsaNI GTAC 1 cut(s) 67
SaqAI TTAA 3 cut(s) 51, 156, 213
Sau3AI GATC 1 cut(s) 108
SetI ASST 5 cut(s) 11, 50, 60, 75, 139
SgeI CNNG 9 cut(s) 30, 36, 85, 99, 124, 150, 199, 239, 245
SmlI CTYRAG 1 cut(s) 112
SmoI CTYRAG 1 cut(s) 112
Sse9I AATT 2 cut(s) 39, 151
SspMI CTAG 1 cut(s) 249
TaaI ACNGT 1 cut(s) 218
TaiI ACGT 2 cut(s) 60, 75
TasI AATT 2 cut(s) 39, 151
Tru1I TTAA 3 cut(s) 51, 156, 213
Tru9I TTAA 3 cut(s) 51, 156, 213
TseFI GTSAC 1 cut(s) 89
Tsp45I GTSAC 1 cut(s) 89
TspDTI ATGAA 2 cut(s) 17, 243
XapI RAATTY 1 cut(s) 151
XmiI GTMKAC 1 cut(s) 128
XspI CTAG 1 cut(s) 249
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.