AT5G02140

thaumatin-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
OG0005684
Physical Location & Seq
Forward (+)
423202 .. 424437
1236 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G02140.1

Sequence Viewer

Length: 885 bp
ATGACGAAATCTGCAACTCTATTCCTTCTCTTTCTCACTATCTCAGCCTTCACTGATGGAGCTCAGCTTATAATAGTGAATAACTGCCAGGAGAGCATTTGGCCGGGAATTCTCGGCGGCGGAGGCCAAATCACACCAAGAAACGGCGGATTCCACATGGGAAGCGGCGAAGAAACCATCATAGACGTACCGGATAAATGGTCCGGTCGAATCTGGGGTAGACAAGGCTGCACCTTTAACCAAAACGGTAAAGGCTCATGCCAAACCGGAGACTGCAACGACGGCTCTATCAACTGCCAAGGAACCGGCGGTGTACCACCAGCAACCGTAGTAGAAATGACATTAGGCTCATCTTCCTCTCCGCTTCATTTCTACGACGTAAGTCTCGTCGACGGTTTCAATCTTCCGGTGTCGATGAAACCAATCGGCGGTGGAGTTGGATGTGGCGTTGCGGCTTGTGAAGTGAATTTGAACATTTGTTGTCCATCAGCTTTGGAAGTTAAGAGAGATGGGAAAGTGGTTGGTTGTAAAAGTGCTTGCTTGGCGATGCAATCGGCTAAGTATTGTTGCACCGGTGAATATGCGAATCCTCAGGCGTGTAAGCCGACTCTGTTCGCGAATCTGTTTAAAGCGATTTGTCCTAAAGCTTATAGTTATGCGTTTGATGATTCTAGTAGTTTGAATAAGTGTAGAGCTTCTCGTTATGTTATCACTTTCTGTCCTCCAAAGTCATTGAATGAGAAACTGAGAAAATTTGAACTCAAAATAGAATCAAAATTTGGTCATTATACAGTGGTTACCATCCTTTTAACTAGTGTTCTAAAGACACAAGCTTTAGCTGGTGGGTCCAAAGACATAAAAGACGGTTTTAGTGCTTACTCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Thaumatin

Protein Analysis

294

Amino Acids

31.17

Weight (kDa)

8.39

Isoelectric Point (pI)

41.79

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Thaumatin PF00314 27 - 241 2.4e-79 Thaumatin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 71
AccI GTMKAC 2 cut(s) 220, 390
AccII CGCG 1 cut(s) 617
AciI CCGC 8 cut(s) 117, 120, 147, 165, 309, 362, 429, 452
AcoI YGGCCR 1 cut(s) 101
AcsI RAATTY 4 cut(s) 108, 466, 752, 776
AfaI GTAC 2 cut(s) 189, 315
AfiI CCNNNNNNNGG 2 cut(s) 143, 428
AgeI ACCGGT 1 cut(s) 572
AgsI TTSAA 5 cut(s) 400, 472, 682, 736, 758
AhlI ACTAGT 1 cut(s) 812
AjnI CCWGG 1 cut(s) 87
AjuI GAANNNNNNNTTGG 2 cut(s) 762, 794
AluBI AGCT 7 cut(s) 62, 67, 491, 647, 695, 833, 839
AluI AGCT 7 cut(s) 62, 67, 491, 647, 695, 833, 839
Alw21I GWGCWC 1 cut(s) 64
Alw26I GTCTC 2 cut(s) 264, 389
AoxI GGCC 2 cut(s) 101, 124
ApeKI GCWGC 1 cut(s) 228
ApoI RAATTY 4 cut(s) 108, 466, 752, 776
AsiGI ACCGGT 1 cut(s) 572
AspS9I GGNCC 2 cut(s) 201, 846
AsuC2I CCSGG 1 cut(s) 105
AsuHPI GGTGA 1 cut(s) 587
AvaII GGWCC 2 cut(s) 201, 846
AxyI CCTNAGG 1 cut(s) 591
BanII GRGCYC 1 cut(s) 64
Bbv12I GWGCWC 1 cut(s) 64
BbvI GCAGC 1 cut(s) 215
BccI CCATC 5 cut(s) 50, 185, 493, 503, 809
BceAI ACGGC 2 cut(s) 160, 298
BciT130I CCWGG 1 cut(s) 89
BcnI CCSGG 1 cut(s) 105
BcoDI GTCTC 2 cut(s) 264, 389
BcuI ACTAGT 1 cut(s) 812
BfaI CTAG 2 cut(s) 672, 813
BisI GCNGC 4 cut(s) 118, 166, 229, 453
BlpI GCTNAGC 1 cut(s) 63
BlsI GCNGC 4 cut(s) 119, 167, 230, 454
Bme1390I CCNGG 2 cut(s) 89, 105
Bme18I GGWCC 2 cut(s) 201, 846
BmgT120I GGNCC 2 cut(s) 201, 846
BmiI GGNNCC 2 cut(s) 304, 847
BmrFI CCNGG 2 cut(s) 89, 105
BmsI GCATC 1 cut(s) 537
BoxI GACNNNNGTC 1 cut(s) 381
Bpu1102I GCTNAGC 1 cut(s) 63
BpuMI CCSGG 1 cut(s) 105
BsaJI CCNNGG 1 cut(s) 298
BsaWI WCCGGW 5 cut(s) 190, 203, 266, 406, 572
Bsc4I CCNNNNNNNGG 2 cut(s) 143, 428
Bse118I RCCGGY 2 cut(s) 305, 572
Bse21I CCTNAGG 1 cut(s) 591
BseBI CCWGG 1 cut(s) 89
BseDI CCNNGG 1 cut(s) 298
BseGI GGATG 2 cut(s) 446, 801
BseLI CCNNNNNNNGG 2 cut(s) 143, 428
BseMII CTCAG 4 cut(s) 57, 77, 605, 737
BseXI GCAGC 1 cut(s) 215
BsgI GTGCAG 1 cut(s) 214
Bsh1236I CGCG 1 cut(s) 617
Bsh1285I CGRYCG 1 cut(s) 208
BshFI GGCC 2 cut(s) 103, 126
BshTI ACCGGT 1 cut(s) 572
BsiEI CGRYCG 1 cut(s) 208
BsiHKAI GWGCWC 1 cut(s) 64
BsiSI CCGG 7 cut(s) 104, 191, 204, 267, 306, 407, 573
BslI CCNNNNNNNGG 2 cut(s) 143, 428
BsmAI GTCTC 2 cut(s) 264, 389
BsnI GGCC 2 cut(s) 103, 126
Bsp1286I GDGCHC 1 cut(s) 64
Bsp1720I GCTNAGC 1 cut(s) 63
Bsp68I TCGCGA 1 cut(s) 617
BspACI CCGC 8 cut(s) 117, 120, 147, 165, 309, 362, 429, 452
BspANI GGCC 2 cut(s) 103, 126
BspCNI CTCAG 4 cut(s) 56, 76, 604, 738
BspFNI CGCG 1 cut(s) 617
BspHI TCATGA 1 cut(s) 881
BspLI GGNNCC 2 cut(s) 304, 847
BsrFI RCCGGY 2 cut(s) 305, 572
BssAI RCCGGY 2 cut(s) 305, 572
BssECI CCNNGG 1 cut(s) 298
BssT1I CCWWGG 1 cut(s) 298
Bst2UI CCWGG 1 cut(s) 89
Bst4CI ACNGT 5 cut(s) 248, 328, 395, 793, 866
BstC8I GCNNGC 1 cut(s) 538
BstDEI CTNAG 5 cut(s) 43, 63, 558, 591, 746
BstEII GGTNACC 1 cut(s) 796
BstF5I GGATG 2 cut(s) 446, 801
BstFNI CGCG 1 cut(s) 617
BstMAI GTCTC 2 cut(s) 264, 389
BstMCI CGRYCG 1 cut(s) 208
BstMWI GCNNNNNNNGC 4 cut(s) 93, 123, 282, 542
BstNI CCWGG 1 cut(s) 89
BstPAI GACNNNNGTC 1 cut(s) 381
BstPI GGTNACC 1 cut(s) 796
BstSCI CCNGG 2 cut(s) 87, 103
BstUI CGCG 1 cut(s) 617
BstV1I GCAGC 1 cut(s) 215
Bsu36I CCTNAGG 1 cut(s) 591
BsuRI GGCC 2 cut(s) 103, 126
BtgZI GCGATG 1 cut(s) 560
BtsCI GGATG 2 cut(s) 446, 801
BtsIMutI CAGTG 2 cut(s) 51, 798
BtuMI TCGCGA 1 cut(s) 617
Cac8I GCNNGC 1 cut(s) 538
CciI TCATGA 1 cut(s) 881
Cfr10I RCCGGY 2 cut(s) 305, 572
Cfr13I GGNCC 2 cut(s) 201, 846
Csp6I GTAC 2 cut(s) 188, 314
CspAI ACCGGT 1 cut(s) 572
CviAII CATG 3 cut(s) 157, 258, 882
CviQI GTAC 2 cut(s) 188, 314
DdeI CTNAG 5 cut(s) 43, 63, 558, 591, 746
DraI TTTAAA 1 cut(s) 628
EaeI YGGCCR 1 cut(s) 101
EciI GGCGGA 2 cut(s) 135, 162
Ecl136II GAGCTC 1 cut(s) 62
Eco130I CCWWGG 1 cut(s) 298
Eco24I GRGCYC 1 cut(s) 64
Eco47I GGWCC 2 cut(s) 201, 846
Eco53kI GAGCTC 1 cut(s) 62
Eco81I CCTNAGG 1 cut(s) 591
Eco91I GGTNACC 1 cut(s) 796
EcoICRI GAGCTC 1 cut(s) 62
EcoO65I GGTNACC 1 cut(s) 796
EcoRI GAATTC 1 cut(s) 108
EcoRII CCWGG 1 cut(s) 87
EcoT14I CCWWGG 1 cut(s) 298
EcoT38I GRGCYC 1 cut(s) 64
ErhI CCWWGG 1 cut(s) 298
FaeI CATG 3 cut(s) 160, 261, 885
FatI CATG 3 cut(s) 156, 257, 881
FblI GTMKAC 2 cut(s) 220, 390
Fnu4HI GCNGC 4 cut(s) 118, 166, 229, 453
FokI GGATG 2 cut(s) 453, 788
FriOI GRGCYC 1 cut(s) 64
Fsp4HI GCNGC 4 cut(s) 118, 166, 229, 453
FspBI CTAG 2 cut(s) 672, 813
GluI GCNGC 4 cut(s) 118, 166, 229, 453
HaeIII GGCC 2 cut(s) 103, 126
HapII CCGG 7 cut(s) 104, 191, 204, 267, 306, 407, 573
Hin1II CATG 3 cut(s) 160, 261, 885
HincII GTYRAC 1 cut(s) 391
HindII GTYRAC 1 cut(s) 391
HindIII AAGCTT 2 cut(s) 645, 831
HinfI GANTC 7 cut(s) 150, 210, 586, 607, 619, 668, 770
HpaII CCGG 7 cut(s) 104, 191, 204, 267, 306, 407, 573
HphI GGTGA 1 cut(s) 587
Hpy166II GTNNAC 3 cut(s) 221, 314, 391
Hpy188III TCNNGA 2 cut(s) 616, 882
Hpy8I GTNNAC 3 cut(s) 221, 314, 391
Hpy99I CGWCG 4 cut(s) 284, 380, 392, 395
HpyAV CCTTC 2 cut(s) 35, 58
HpyCH4III ACNGT 5 cut(s) 248, 328, 395, 793, 866
HpyCH4IV ACGT 2 cut(s) 186, 378
HpyCH4V TGCA 5 cut(s) 14, 231, 276, 550, 570
HpyF10VI GCNNNNNNNGC 4 cut(s) 93, 123, 282, 542
HpyF3I CTNAG 5 cut(s) 43, 63, 558, 591, 746
HpySE526I ACGT 2 cut(s) 186, 378
Hsp92II CATG 3 cut(s) 160, 261, 885
LmnI GCTCC 1 cut(s) 59
Lsp1109I GCAGC 1 cut(s) 215
LweI GCATC 1 cut(s) 537
MaeI CTAG 2 cut(s) 672, 813
MaeII ACGT 2 cut(s) 186, 378
MaeIII GTNAC 1 cut(s) 796
MboII GAAGA 3 cut(s) 182, 345, 395
MhlI GDGCHC 1 cut(s) 64
MluCI AATT 4 cut(s) 108, 466, 752, 776
MlyI GAGTC 1 cut(s) 601
MmeI TCCRAC 1 cut(s) 418
MnlI CCTC 4 cut(s) 116, 367, 600, 732
MseI TTAA 4 cut(s) 237, 501, 627, 809
MspI CCGG 7 cut(s) 104, 191, 204, 267, 306, 407, 573
MspR9I CCNGG 2 cut(s) 89, 105
MvaI CCWGG 1 cut(s) 89
MvnI CGCG 1 cut(s) 617
MwoI GCNNNNNNNGC 4 cut(s) 93, 123, 282, 542
NciI CCSGG 1 cut(s) 105
NlaIII CATG 3 cut(s) 160, 261, 885
NlaIV GGNNCC 2 cut(s) 304, 847
NmeAIII GCCGAG 1 cut(s) 93
NruI TCGCGA 1 cut(s) 617
PagI TCATGA 1 cut(s) 881
PcsI WCGNNNNNNNCGW 1 cut(s) 384
PfeI GAWTC 6 cut(s) 150, 210, 586, 619, 668, 770
PinAI ACCGGT 1 cut(s) 572
PkrI GCNGC 4 cut(s) 119, 167, 230, 454
PleI GAGTC 1 cut(s) 601
PpsI GAGTC 1 cut(s) 601
PshAI GACNNNNGTC 1 cut(s) 381
PsiI TTATAA 1 cut(s) 71
Psp124BI GAGCTC 1 cut(s) 64
Psp6I CCWGG 1 cut(s) 87
PspEI GGTNACC 1 cut(s) 796
PspGI CCWGG 1 cut(s) 87
PspN4I GGNNCC 2 cut(s) 304, 847
PspPI GGNCC 2 cut(s) 201, 846
RruI TCGCGA 1 cut(s) 617
RsaI GTAC 2 cut(s) 189, 315
RsaNI GTAC 2 cut(s) 188, 314
SacI GAGCTC 1 cut(s) 64
SalI GTCGAC 1 cut(s) 389
SaqAI TTAA 4 cut(s) 237, 501, 627, 809
SatI GCNGC 4 cut(s) 118, 166, 229, 453
Sau96I GGNCC 2 cut(s) 201, 846
SchI GAGTC 1 cut(s) 601
ScrFI CCNGG 2 cut(s) 89, 105
SduI GDGCHC 1 cut(s) 64
SfaNI GCATC 1 cut(s) 537
SgrAI CRCCGGYG 1 cut(s) 572
SgrDI CGTCGACG 1 cut(s) 389
SinI GGWCC 2 cut(s) 201, 846
SpeI ACTAGT 1 cut(s) 812
Sse9I AATT 4 cut(s) 108, 466, 752, 776
SsiI CCGC 8 cut(s) 117, 120, 147, 165, 309, 362, 429, 452
SspMI CTAG 2 cut(s) 672, 813
SstI GAGCTC 1 cut(s) 64
StyD4I CCNGG 2 cut(s) 87, 103
StyI CCWWGG 1 cut(s) 298
TaaI ACNGT 5 cut(s) 248, 328, 395, 793, 866
TaiI ACGT 2 cut(s) 189, 381
TaqI TCGA 3 cut(s) 208, 390, 413
TasI AATT 4 cut(s) 108, 466, 752, 776
TauI GCSGC 3 cut(s) 120, 168, 455
TfiI GAWTC 6 cut(s) 150, 210, 586, 619, 668, 770
Tru1I TTAA 4 cut(s) 237, 501, 627, 809
Tru9I TTAA 4 cut(s) 237, 501, 627, 809
TscAI CASTG 2 cut(s) 58, 798
TseI GCWGC 1 cut(s) 228
TspDTI ATGAA 2 cut(s) 356, 431
TspRI CASTG 2 cut(s) 58, 798
VpaK11BI GGWCC 2 cut(s) 201, 846
XapI RAATTY 4 cut(s) 108, 466, 752, 776
XmiI GTMKAC 2 cut(s) 220, 390
XspI CTAG 2 cut(s) 672, 813
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.