FvH4_2g19022

Lysyl-tRNA synthetase

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb2
Physical Location & Seq
Forward (+)
16187448 .. 16189486
2039 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_2g19022.t1

Sequence Viewer

Length: 366 bp
ATGAGATTGGACGAATATTTAGGAATGAAGGCATTTCAACTCGTCATAATCCTGAATTTACCACTTAGAGGGAGGAGGGAAACCATACACAATCTTGTCAAAGATGCCACTGGAATTACTTTCAATGAGTTAGGCAATGATCTTCAAGTTGCTAAAGAAGTTACTCTGAAGAACCTAGGAGTTGACCTTGATTACAAATACAAATCTTCTATTGAAGCATGCTCATCTATTGGCGACCTTCTTAATGAGGTTGATGCAAATCTATACTACAAGGGTTTTGTGATGTCGTGGACGGATGGGATAGCTTCTGATCTTAGCAGGACCTTTCCGGTTGAAAGAGACATTGAGCAGAAGACTGGATTATAA

Protein Analysis

122

Amino Acids

13.65

Weight (kDa)

4.95

Isoelectric Point (pI)

40.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 364
AcsI RAATTY 1 cut(s) 55
AcuI CTGAAG 1 cut(s) 188
AfiI CCNNNNNNNGG 1 cut(s) 68
AgsI TTSAA 5 cut(s) 38, 124, 146, 215, 335
AluBI AGCT 1 cut(s) 305
AluI AGCT 1 cut(s) 305
Alw26I GTCTC 1 cut(s) 333
ApoI RAATTY 1 cut(s) 55
AspA2I CCTAGG 1 cut(s) 175
AspS9I GGNCC 1 cut(s) 321
AvaII GGWCC 1 cut(s) 321
AvrII CCTAGG 1 cut(s) 175
BbsI GAAGAC 1 cut(s) 359
BccI CCATC 1 cut(s) 290
BcoDI GTCTC 1 cut(s) 333
BfaI CTAG 1 cut(s) 176
BlnI CCTAGG 1 cut(s) 175
Bme18I GGWCC 1 cut(s) 321
BmgT120I GGNCC 1 cut(s) 321
BmsI GCATC 2 cut(s) 94, 244
BpiI GAAGAC 1 cut(s) 359
BsaBI GATNNNNATC 1 cut(s) 258
BsaJI CCNNGG 1 cut(s) 175
BsaWI WCCGGW 1 cut(s) 328
Bsc4I CCNNNNNNNGG 1 cut(s) 68
Bse1I ACTGG 2 cut(s) 115, 361
Bse3DI GCAATG 1 cut(s) 142
Bse8I GATNNNNATC 1 cut(s) 258
BseDI CCNNGG 1 cut(s) 175
BseGI GGATG 1 cut(s) 301
BseJI GATNNNNATC 1 cut(s) 258
BseLI CCNNNNNNNGG 1 cut(s) 68
BseMI GCAATG 1 cut(s) 142
BseNI ACTGG 2 cut(s) 115, 361
BseRI GAGGAG 1 cut(s) 88
BsiSI CCGG 1 cut(s) 329
BslI CCNNNNNNNGG 1 cut(s) 68
BsmAI GTCTC 1 cut(s) 333
Bsp143I GATC 2 cut(s) 139, 310
BsrDI GCAATG 1 cut(s) 142
BsrI ACTGG 2 cut(s) 115, 361
BssECI CCNNGG 1 cut(s) 175
BssMI GATC 2 cut(s) 139, 310
BssT1I CCWWGG 1 cut(s) 175
BstC8I GCNNGC 1 cut(s) 220
BstDEI CTNAG 2 cut(s) 65, 314
BstF5I GGATG 1 cut(s) 301
BstKTI GATC 2 cut(s) 142, 313
BstMAI GTCTC 1 cut(s) 333
BstMBI GATC 2 cut(s) 139, 310
BstNSI RCATGY 1 cut(s) 222
BstV2I GAAGAC 1 cut(s) 359
BtsCI GGATG 1 cut(s) 301
BtsIMutI CAGTG 1 cut(s) 108
Cac8I GCNNGC 1 cut(s) 220
Cfr13I GGNCC 1 cut(s) 321
CviAII CATG 1 cut(s) 219
CviJI RGCY 1 cut(s) 305
CviKI_1 RGCY 1 cut(s) 305
DdeI CTNAG 2 cut(s) 65, 314
DpnI GATC 2 cut(s) 141, 312
DpnII GATC 2 cut(s) 139, 310
Eco130I CCWWGG 1 cut(s) 175
Eco47I GGWCC 1 cut(s) 321
Eco57I CTGAAG 1 cut(s) 188
EcoO109I RGGNCCY 1 cut(s) 321
EcoT14I CCWWGG 1 cut(s) 175
ErhI CCWWGG 1 cut(s) 175
FaeI CATG 1 cut(s) 222
FaiI YATR 5 cut(s) 47, 86, 220, 265, 364
FatI CATG 1 cut(s) 218
FokI GGATG 1 cut(s) 308
FspBI CTAG 1 cut(s) 176
HapII CCGG 1 cut(s) 329
Hin1II CATG 1 cut(s) 222
HincII GTYRAC 1 cut(s) 184
HindII GTYRAC 1 cut(s) 184
HpaII CCGG 1 cut(s) 329
Hpy166II GTNNAC 2 cut(s) 184, 291
Hpy188I TCNGA 2 cut(s) 168, 310
Hpy188III TCNNGA 1 cut(s) 52
Hpy8I GTNNAC 2 cut(s) 184, 291
HpyAV CCTTC 2 cut(s) 22, 248
HpyCH4V TGCA 1 cut(s) 257
HpyF3I CTNAG 2 cut(s) 65, 314
Hsp92II CATG 1 cut(s) 222
Kzo9I GATC 2 cut(s) 139, 310
LpnPI CCDG 5 cut(s) 65, 96, 304, 342, 342
LweI GCATC 2 cut(s) 94, 244
MaeI CTAG 1 cut(s) 176
MaeIII GTNAC 1 cut(s) 160
MalI GATC 2 cut(s) 141, 312
MboI GATC 2 cut(s) 139, 310
MboII GAAGA 4 cut(s) 134, 181, 198, 364
MluCI AATT 2 cut(s) 55, 114
MnlI CCTC 4 cut(s) 62, 66, 69, 241
MseI TTAA 1 cut(s) 243
MspI CCGG 1 cut(s) 329
NdeII GATC 2 cut(s) 139, 310
NlaIII CATG 1 cut(s) 222
NspI RCATGY 1 cut(s) 222
PaeI GCATGC 1 cut(s) 222
PpuMI RGGWCCY 1 cut(s) 321
PsiI TTATAA 1 cut(s) 364
Psp5II RGGWCCY 1 cut(s) 321
PspPI GGNCC 1 cut(s) 321
PspPPI RGGWCCY 1 cut(s) 321
SaqAI TTAA 1 cut(s) 243
Sau3AI GATC 2 cut(s) 139, 310
Sau96I GGNCC 1 cut(s) 321
SetI ASST 6 cut(s) 177, 189, 240, 252, 307, 326
SfaNI GCATC 2 cut(s) 94, 244
SinI GGWCC 1 cut(s) 321
SphI GCATGC 1 cut(s) 222
Sse9I AATT 2 cut(s) 55, 114
SspI AATATT 1 cut(s) 17
SspMI CTAG 1 cut(s) 176
StyI CCWWGG 1 cut(s) 175
TasI AATT 2 cut(s) 55, 114
Tru1I TTAA 1 cut(s) 243
Tru9I TTAA 1 cut(s) 243
TscAI CASTG 1 cut(s) 115
TspDTI ATGAA 1 cut(s) 41
TspGWI ACGGA 1 cut(s) 308
TspRI CASTG 1 cut(s) 115
VpaK11BI GGWCC 1 cut(s) 321
XapI RAATTY 1 cut(s) 55
XceI RCATGY 1 cut(s) 222
XmaJI CCTAGG 1 cut(s) 175
XspI CTAG 1 cut(s) 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.