FvH4_3g26473

zinc finger CCCH domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
OG0009668
Physical Location & Seq
Forward (+)
19576991 .. 19577699
709 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g26473.t1

Sequence Viewer

Length: 249 bp
ATGGCAAATGGCCGTCTAGAGAAACCTACTGTTGTTGAGCTCGAAAGGAAGGCAAGAGAACTACATCAGGACATAACTAAGCATTGGATTGAAAAGGAGTTGATGAGATTGCAGAATTCGGTTGATCAGGCAAATGAGAAAGGATGGAGAACAGAATATCCTTCCATAGTATTTATGAATTCTTGTTTTTTTTTCATCAGACTGAGTGCTAATTTGATTTTGAAATTTATTAATGATCACCAGAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Plus-3 SWIB

Protein Analysis

83

Amino Acids

9.82

Weight (kDa)

7.94

Isoelectric Point (pI)

28.14

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NERD_plant PF25980 23 - 56 2.2e-17 Plant NERD domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 10
AcsI RAATTY 3 cut(s) 115, 178, 224
AgsI TTSAA 2 cut(s) 92, 223
AloI GAACNNNNNNTCC 2 cut(s) 142, 174
AluBI AGCT 1 cut(s) 40
AluI AGCT 1 cut(s) 40
Alw21I GWGCWC 1 cut(s) 42
AoxI GGCC 1 cut(s) 10
ApoI RAATTY 3 cut(s) 115, 178, 224
AseI ATTAAT 1 cut(s) 231
AsuHPI GGTGA 1 cut(s) 230
BanII GRGCYC 1 cut(s) 42
Bbv12I GWGCWC 1 cut(s) 42
BccI CCATC 1 cut(s) 138
BclI TGATCA 2 cut(s) 124, 235
BfaI CTAG 1 cut(s) 17
BseGI GGATG 1 cut(s) 149
BseMII CTCAG 1 cut(s) 194
BshFI GGCC 1 cut(s) 12
BsiHKAI GWGCWC 1 cut(s) 42
BsnI GGCC 1 cut(s) 12
Bsp1286I GDGCHC 1 cut(s) 42
Bsp143I GATC 2 cut(s) 124, 235
BspANI GGCC 1 cut(s) 12
BspCNI CTCAG 1 cut(s) 195
BssMI GATC 2 cut(s) 124, 235
Bst4CI ACNGT 1 cut(s) 31
BstDEI CTNAG 2 cut(s) 78, 203
BstF5I GGATG 1 cut(s) 149
BstKTI GATC 2 cut(s) 127, 238
BstMBI GATC 2 cut(s) 124, 235
BsuRI GGCC 1 cut(s) 12
BtsCI GGATG 1 cut(s) 149
CviJI RGCY 2 cut(s) 12, 40
CviKI_1 RGCY 2 cut(s) 12, 40
DdeI CTNAG 2 cut(s) 78, 203
DpnI GATC 2 cut(s) 126, 237
DpnII GATC 2 cut(s) 124, 235
EaeI YGGCCR 1 cut(s) 10
Ecl136II GAGCTC 1 cut(s) 40
Eco24I GRGCYC 1 cut(s) 42
Eco53kI GAGCTC 1 cut(s) 40
EcoICRI GAGCTC 1 cut(s) 40
EcoRI GAATTC 2 cut(s) 115, 178
EcoT38I GRGCYC 1 cut(s) 42
FaiI YATR 3 cut(s) 74, 167, 176
FbaI TGATCA 2 cut(s) 124, 235
FokI GGATG 1 cut(s) 156
FriOI GRGCYC 1 cut(s) 42
FspBI CTAG 1 cut(s) 17
HaeIII GGCC 1 cut(s) 12
HphI GGTGA 1 cut(s) 230
Hpy188I TCNGA 1 cut(s) 200
Hpy188III TCNNGA 2 cut(s) 17, 68
HpyAV CCTTC 2 cut(s) 43, 171
HpyCH4III ACNGT 1 cut(s) 31
HpyCH4V TGCA 1 cut(s) 112
HpyF3I CTNAG 2 cut(s) 78, 203
Ksp22I TGATCA 2 cut(s) 124, 235
Kzo9I GATC 2 cut(s) 124, 235
LpnPI CCDG 2 cut(s) 53, 113
MaeI CTAG 1 cut(s) 17
MalI GATC 2 cut(s) 126, 237
MboI GATC 2 cut(s) 124, 235
MhlI GDGCHC 1 cut(s) 42
MluCI AATT 4 cut(s) 115, 178, 211, 224
MseI TTAA 1 cut(s) 231
NdeII GATC 2 cut(s) 124, 235
PshBI ATTAAT 1 cut(s) 231
Psp124BI GAGCTC 1 cut(s) 42
SacI GAGCTC 1 cut(s) 42
SaqAI TTAA 1 cut(s) 231
Sau3AI GATC 2 cut(s) 124, 235
SduI GDGCHC 1 cut(s) 42
SetI ASST 2 cut(s) 28, 42
SgeI CNNG 6 cut(s) 29, 53, 66, 80, 140, 195
Sse9I AATT 4 cut(s) 115, 178, 211, 224
SspMI CTAG 1 cut(s) 17
SstI GAGCTC 1 cut(s) 42
TaaI ACNGT 1 cut(s) 31
TaqI TCGA 1 cut(s) 42
TasI AATT 4 cut(s) 115, 178, 211, 224
Tru1I TTAA 1 cut(s) 231
Tru9I TTAA 1 cut(s) 231
TspDTI ATGAA 2 cut(s) 184, 191
VspI ATTAAT 1 cut(s) 231
XapI RAATTY 3 cut(s) 115, 178, 224
XbaI TCTAGA 1 cut(s) 16
XspI CTAG 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.