Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr15

Orthogroup ID

OG0009668

Physical Location & Seq

Genomic Coordinates Reverse (-)

51428611 .. 51429238

Gene Structure 628 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD15G1414400.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 189 bp

ATGGACATATCGGACGAATGCAAGGAGTTGCAGAAAAATGTGGCAAACGGCCTGCTAAGGAAACCTACAGTTGTTGAGCTTGAGCAGAAGGCACAACTTCTGCATGATGATATAGCTAAGCATTTGGTCAGATTACAGAACTGCATTGATCGAGCAAACGAGAAAGGACGAAGAAGAGAATATCCTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Plus-3 SWIB

Protein Analysis

63

Amino Acids

7.24

Weight (kDa)

7.81

Isoelectric Point (pI)

47.43

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
NERD_plant	PF25980	36 - 62	3.9e-11	Plant NERD domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009668)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g26473 FvH4_6g52630 FvH4_7g09440
malus_domestica	MD15G1414400.v1.1 MD15G1414500.v1.1
rosa_chinensis	RchiOBHm_Chr1g0336751 RchiOBHm_Chr1g0346081
rosa_laevigata	RLG00000028815
rosa_multiflora	Rmu_sc0000907.1_g000013 Rmu_sc0003809.1_g000021 Rmu_ssc0000255.1_g000071
rosa_roxburghii	Rroxscaffold_4G00308830
rosa_rugosa	Rorug01G0177900
rosa_samantha	Rh1AG148800 Rh1AG197400 Rh1BG162700 Rh1CG182400 Rh1DG193300 Rh2CG357500 Rh6BG094500
rosa_wichuraiana	Rw1G016340 Rw1G016570

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AluBI	AGCT	2 cut(s)	79, 116
AluI	AGCT	2 cut(s)	79, 116
AoxI	GGCC	1 cut(s)	49
BceAI	ACGGC	1 cut(s)	64
BfmI	CTRYAG	1 cut(s)	66
BlpI	GCTNAGC	1 cut(s)	117
Bpu10I	CCTNAGC	1 cut(s)	56
Bpu1102I	GCTNAGC	1 cut(s)	117
BpuEI	CTTGAG	1 cut(s)	101
BshFI	GGCC	1 cut(s)	51
BsmI	GAATGC	1 cut(s)	23
BsnI	GGCC	1 cut(s)	51
Bsp143I	GATC	1 cut(s)	148
Bsp1720I	GCTNAGC	1 cut(s)	117
BspANI	GGCC	1 cut(s)	51
BssMI	GATC	1 cut(s)	148
Bst4CI	ACNGT	1 cut(s)	70
Bst6I	CTCTTC	1 cut(s)	169
BstC8I	GCNNGC	1 cut(s)	53
BstDEI	CTNAG	3 cut(s)	56, 117, 186
BstKTI	GATC	1 cut(s)	151
BstMBI	GATC	1 cut(s)	148
BstSFI	CTRYAG	1 cut(s)	66
BsuRI	GGCC	1 cut(s)	51
Cac8I	GCNNGC	1 cut(s)	53
CviAII	CATG	1 cut(s)	104
CviJI	RGCY	3 cut(s)	51, 79, 116
CviKI_1	RGCY	3 cut(s)	51, 79, 116
DdeI	CTNAG	3 cut(s)	56, 117, 186
DpnI	GATC	1 cut(s)	150
DpnII	GATC	1 cut(s)	148
Eam1104I	CTCTTC	1 cut(s)	169
EarI	CTCTTC	1 cut(s)	169
FaeI	CATG	1 cut(s)	107
FaiI	YATR	3 cut(s)	8, 105, 113
FatI	CATG	1 cut(s)	103
FspEI	CC	9 cut(s)	8, 26, 33, 43, 65, 74, 78, 110, 150
HaeIII	GGCC	1 cut(s)	51
Hin1II	CATG	1 cut(s)	107
Hpy188I	TCNGA	2 cut(s)	13, 131
HpyAV	CCTTC	1 cut(s)	82
HpyCH4III	ACNGT	1 cut(s)	70
HpyCH4V	TGCA	4 cut(s)	21, 31, 103, 144
HpyF3I	CTNAG	3 cut(s)	56, 117, 186
Hsp92II	CATG	1 cut(s)	107
Kzo9I	GATC	1 cut(s)	148
LpnPI	CCDG	1 cut(s)	65
MalI	GATC	1 cut(s)	150
MboI	GATC	1 cut(s)	148
MboII	GAAGA	2 cut(s)	183, 186
Mva1269I	GAATGC	1 cut(s)	23
NdeII	GATC	1 cut(s)	148
NlaIII	CATG	1 cut(s)	107
PctI	GAATGC	1 cut(s)	23
Sau3AI	GATC	1 cut(s)	148
SetI	ASST	3 cut(s)	67, 81, 118
SfcI	CTRYAG	1 cut(s)	66
SgeI	CNNG	6 cut(s)	34, 64, 92, 116, 164, 172
SmlI	CTYRAG	1 cut(s)	80
SmoI	CTYRAG	1 cut(s)	80
TaaI	ACNGT	1 cut(s)	70
TaqI	TCGA	1 cut(s)	151

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.