Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000907.1

Orthogroup ID

OG0009668

Physical Location & Seq

Genomic Coordinates Forward (+)

47920 .. 48678

Gene Structure 759 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000907.1_g000013.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 759 bp

atgttcgactaccagaactacctaaaagttcaccatcccgaatgtgtagggaaaatgagacccttcactgacggtggaaagctatggacacgaagttggcaatcttgttcagtgtgcagtagaagaaccccagtaaagctttcttgcttttgttgtgcgaaagtgttgtgtggaaactgctgcattagtagtgcttctgagtttccagtggttataggaaataaaagaggcatttgcaagagctgtttagatcttgttctgcttgaagatcaagaaagctcatcagaatatgaaagcgaaagtgatgatgattctgaagaaatcacatcagaagatgaggacgacagaatgaattcaacagaagtgcctatcaatcttcctagcaatattcggaataaaagtcgttgtgcaactttagttgctgaaaacatcaagcttgtctacttgaaaaagagcttggtggaggagttaatgaagctgcagcctgattggtgggaaagcaaagtagttgggagttttgtgagagtcaaaactgatccgagagactattctagggcaaattctcaccaacttgcagaagttcaaggcataagtaagaagagctcaaacagtgagtttttcttgcaagttttatccaattatgtgaccagagatattcctgtttctcatctttcagattgtgacttccgaggaggaatgcgaggatttgcaacaagatgtggcaaactgtcacttgctaagaagacctactgtttttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Plus-3 SWIB

Protein Analysis

252

Amino Acids

28.53

Weight (kDa)

6.87

Isoelectric Point (pI)

53.33

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009668)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g26473 FvH4_6g52630 FvH4_7g09440
malus_domestica	MD15G1414400.v1.1 MD15G1414500.v1.1
rosa_chinensis	RchiOBHm_Chr1g0336751 RchiOBHm_Chr1g0346081
rosa_laevigata	RLG00000028815
rosa_multiflora	Rmu_sc0000907.1_g000013 Rmu_sc0003809.1_g000021 Rmu_ssc0000255.1_g000071
rosa_roxburghii	Rroxscaffold_4G00308830
rosa_rugosa	Rorug01G0177900
rosa_samantha	Rh1AG148800 Rh1AG197400 Rh1BG162700 Rh1CG182400 Rh1DG193300 Rh2CG357500 Rh6BG094500
rosa_wichuraiana	Rw1G016340 Rw1G016570

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	441
AclWI	GGATC	1 cut(s)	530
AcsI	RAATTY	2 cut(s)	352, 559
AcuI	CTGAAG	1 cut(s)	336
AgsI	TTSAA	4 cut(s)	266, 357, 448, 584
AjuI	GAANNNNNNNTTGG	2 cut(s)	440, 472
AluBI	AGCT	8 cut(s)	82, 139, 243, 279, 436, 456, 478, 603
AluI	AGCT	8 cut(s)	82, 139, 243, 279, 436, 456, 478, 603
Alw21I	GWGCWC	1 cut(s)	605
Alw26I	GTCTC	2 cut(s)	52, 537
AlwI	GGATC	1 cut(s)	530
ApeKI	GCWGC	3 cut(s)	180, 478, 481
ApoI	RAATTY	2 cut(s)	352, 559
Asp700I	GAANNNNTTC	1 cut(s)	352
AsuHPI	GGTGA	2 cut(s)	23, 557
BanII	GRGCYC	1 cut(s)	605
BbsI	GAAGAC	1 cut(s)	749
Bbv12I	GWGCWC	1 cut(s)	605
BbvI	GCAGC	3 cut(s)	167, 465, 493
BccI	CCATC	1 cut(s)	42
BcoDI	GTCTC	2 cut(s)	52, 537
BfaI	CTAG	2 cut(s)	381, 552
BfmI	CTRYAG	1 cut(s)	479
BglII	AGATCT	1 cut(s)	250
BisI	GCNGC	3 cut(s)	181, 479, 482
BlsI	GCNGC	3 cut(s)	182, 480, 483
BmrI	ACTGGG	1 cut(s)	125
BmuI	ACTGGG	1 cut(s)	125
BpiI	GAAGAC	1 cut(s)	749
BsaI	GGTCTC	1 cut(s)	52
BsaJI	CCNNGG	1 cut(s)	688
Bse1I	ACTGG	2 cut(s)	131, 206
BseDI	CCNNGG	1 cut(s)	688
BseGI	GGATG	1 cut(s)	34
BseMII	CTCAG	1 cut(s)	189
BseNI	ACTGG	2 cut(s)	131, 206
BseRI	GAGGAG	2 cut(s)	479, 705
BseXI	GCAGC	3 cut(s)	167, 465, 493
BsgI	GTGCAG	1 cut(s)	136
BsiHKAI	GWGCWC	1 cut(s)	605
BsmAI	GTCTC	2 cut(s)	52, 537
BsmI	GAATGC	1 cut(s)	702
Bso31I	GGTCTC	1 cut(s)	52
Bsp1286I	GDGCHC	1 cut(s)	605
Bsp143I	GATC	3 cut(s)	250, 268, 535
BspCNI	CTCAG	1 cut(s)	190
BspMAI	CTGCAG	1 cut(s)	483
BspPI	GGATC	1 cut(s)	530
BspQI	GCTCTTC	1 cut(s)	593
BspTNI	GGTCTC	1 cut(s)	52
BsrI	ACTGG	2 cut(s)	131, 206
BssECI	CCNNGG	1 cut(s)	688
BssMI	GATC	3 cut(s)	250, 268, 535
Bst4CI	ACNGT	4 cut(s)	74, 611, 729, 752
Bst6I	CTCTTC	1 cut(s)	593
BstDEI	CTNAG	2 cut(s)	198, 738
BstF5I	GGATG	1 cut(s)	34
BstKTI	GATC	3 cut(s)	253, 271, 538
BstMAI	GTCTC	2 cut(s)	52, 537
BstMBI	GATC	3 cut(s)	250, 268, 535
BstSFI	CTRYAG	1 cut(s)	479
BstV1I	GCAGC	3 cut(s)	167, 465, 493
BstV2I	GAAGAC	1 cut(s)	749
BstX2I	RGATCY	1 cut(s)	250
BstYI	RGATCY	1 cut(s)	250
BtsCI	GGATG	1 cut(s)	34
BtsIMutI	CAGTG	4 cut(s)	66, 117, 213, 616
CviJI	RGCY	9 cut(s)	82, 139, 243, 279, 436, 456, 478, 484, 603
CviKI_1	RGCY	9 cut(s)	82, 139, 243, 279, 436, 456, 478, 484, 603
DdeI	CTNAG	2 cut(s)	198, 738
DpnI	GATC	3 cut(s)	252, 270, 537
DpnII	GATC	3 cut(s)	250, 268, 535
Eam1104I	CTCTTC	1 cut(s)	593
EarI	CTCTTC	1 cut(s)	593
Ecl136II	GAGCTC	1 cut(s)	603
Eco24I	GRGCYC	1 cut(s)	605
Eco31I	GGTCTC	1 cut(s)	52
Eco53kI	GAGCTC	1 cut(s)	603
Eco57I	CTGAAG	1 cut(s)	336
EcoICRI	GAGCTC	1 cut(s)	603
EcoRI	GAATTC	1 cut(s)	352
EcoT38I	GRGCYC	1 cut(s)	605
FaiI	YATR	5 cut(s)	85, 215, 291, 590, 642
FblI	GTMKAC	1 cut(s)	441
Fnu4HI	GCNGC	3 cut(s)	181, 479, 482
FokI	GGATG	1 cut(s)	21
FriOI	GRGCYC	1 cut(s)	605
Fsp4HI	GCNGC	3 cut(s)	181, 479, 482
FspBI	CTAG	2 cut(s)	381, 552
GluI	GCNGC	3 cut(s)	181, 479, 482
HindIII	AAGCTT	2 cut(s)	137, 434
HinfI	GANTC	2 cut(s)	311, 525
HphI	GGTGA	2 cut(s)	23, 557
Hpy166II	GTNNAC	2 cut(s)	31, 442
Hpy188I	TCNGA	8 cut(s)	199, 286, 316, 331, 393, 540, 676, 689
Hpy188III	TCNNGA	2 cut(s)	38, 272
Hpy8I	GTNNAC	2 cut(s)	31, 442
HpyAV	CCTTC	1 cut(s)	73
HpyCH4III	ACNGT	4 cut(s)	74, 611, 729, 752
HpyCH4V	TGCA	8 cut(s)	117, 183, 237, 410, 481, 575, 625, 710
HpyF3I	CTNAG	2 cut(s)	198, 738
Kzo9I	GATC	3 cut(s)	250, 268, 535
LguI	GCTCTTC	1 cut(s)	593
LpnPI	CCDG	6 cut(s)	26, 144, 219, 498, 661, 672
Lsp1109I	GCAGC	3 cut(s)	167, 465, 493
MaeI	CTAG	2 cut(s)	381, 552
MaeIII	GTNAC	3 cut(s)	643, 680, 729
MalI	GATC	3 cut(s)	252, 270, 537
MboI	GATC	3 cut(s)	250, 268, 535
MboII	GAAGA	7 cut(s)	135, 278, 329, 344, 368, 610, 754
MflI	RGATCY	1 cut(s)	250
MhlI	GDGCHC	1 cut(s)	605
MluCI	AATT	3 cut(s)	352, 559, 637
MlyI	GAGTC	1 cut(s)	534
MnlI	CCTC	6 cut(s)	221, 331, 457, 683, 686, 695
MroXI	GAANNNNTTC	1 cut(s)	352
MseI	TTAA	1 cut(s)	470
Mva1269I	GAATGC	1 cut(s)	702
NdeII	GATC	3 cut(s)	250, 268, 535
NmuCI	GTSAC	3 cut(s)	643, 680, 729
PciSI	GCTCTTC	1 cut(s)	593
PctI	GAATGC	1 cut(s)	702
PdmI	GAANNNNTTC	1 cut(s)	352
PfeI	GAWTC	1 cut(s)	311
PkrI	GCNGC	3 cut(s)	182, 480, 483
PleI	GAGTC	1 cut(s)	533
PpsI	GAGTC	1 cut(s)	533
Psp124BI	GAGCTC	1 cut(s)	605
PstI	CTGCAG	1 cut(s)	483
PsuI	RGATCY	1 cut(s)	250
SacI	GAGCTC	1 cut(s)	605
SapI	GCTCTTC	1 cut(s)	593
SaqAI	TTAA	1 cut(s)	470
SatI	GCNGC	3 cut(s)	181, 479, 482
Sau3AI	GATC	3 cut(s)	250, 268, 535
SchI	GAGTC	1 cut(s)	534
SduI	GDGCHC	1 cut(s)	605
SfcI	CTRYAG	1 cut(s)	479
Sse9I	AATT	3 cut(s)	352, 559, 637
SspI	AATATT	1 cut(s)	388
SspMI	CTAG	2 cut(s)	381, 552
SstI	GAGCTC	1 cut(s)	605
TaaI	ACNGT	4 cut(s)	74, 611, 729, 752
TaqI	TCGA	1 cut(s)	6
TasI	AATT	3 cut(s)	352, 559, 637
TfiI	GAWTC	1 cut(s)	311
Tru1I	TTAA	1 cut(s)	470
Tru9I	TTAA	1 cut(s)	470
TscAI	CASTG	4 cut(s)	73, 117, 213, 616
TseFI	GTSAC	3 cut(s)	643, 680, 729
TseI	GCWGC	3 cut(s)	180, 478, 481
Tsp45I	GTSAC	3 cut(s)	643, 680, 729
TspDTI	ATGAA	3 cut(s)	306, 365, 488
TspRI	CASTG	4 cut(s)	73, 117, 213, 616
XapI	RAATTY	2 cut(s)	352, 559
XmiI	GTMKAC	1 cut(s)	441
XmnI	GAANNNNTTC	1 cut(s)	352
XspI	CTAG	2 cut(s)	381, 552

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.