FvH4_3g44530

F-box LRR-repeat protein

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
Physical Location & Seq
Reverse (-)
37106162 .. 37107928
1767 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g44530.t1

Sequence Viewer

Length: 468 bp
ATGGCTACAAGGAAACGAGGGTATATTAATTCCATGTTGCAGGACGATTTACTTGCCCAAATCCTTAGCAAGGTCGACAACAATGATGTAGGATTGGGATTCCTGGCAAATGCTAAAACCCTCAAGAAATTGATCCTTGAGCATTGTGATGGAATCACCGATACTGGGATCCAGCTTTTGGTCAACTTGGGTAGCTTAGAGCACCTAGAACTGGCCTCATTGAACAAATTGACTGATACCGGAGGTGTGGCAATCTTGACAATTCAAACCCTCAGGGAATTAAAACCGAGTGAGATTTGGAAGTTGTCAGACCGTACAGTTGTTGCCCTTGCTGAGAACTGCCGCAACTTGGAAGTACTTGTCTTGGATCGTATAAGGTATCGTATAGATGAACCTTTGCTTGGACATGCACCACAAGTGGCTGTAAATGGGCTTTGCCGCCCCAGAAACCGCCTCCGATGGAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

156

Amino Acids

17.38

Weight (kDa)

8.88

Isoelectric Point (pI)

23.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 178
AccI GTMKAC 1 cut(s) 75
AciI CCGC 3 cut(s) 343, 439, 451
AclWI GGATC 4 cut(s) 127, 163, 176, 375
AfaI GTAC 2 cut(s) 316, 357
AfiI CCNNNNNNNGG 6 cut(s) 70, 165, 178, 211, 349, 401
AgsI TTSAA 2 cut(s) 223, 266
AjnI CCWGG 1 cut(s) 102
AjuI GAANNNNNNNTTGG 2 cut(s) 384, 416
AluBI AGCT 2 cut(s) 175, 195
AluI AGCT 2 cut(s) 175, 195
Alw21I GWGCWC 1 cut(s) 204
AlwI GGATC 4 cut(s) 127, 163, 176, 375
AoxI GGCC 1 cut(s) 213
AseI ATTAAT 1 cut(s) 27
AsuHPI GGTGA 1 cut(s) 148
AxyI CCTNAGG 1 cut(s) 272
BamHI GGATCC 1 cut(s) 168
Bbv12I GWGCWC 1 cut(s) 204
BccI CCATC 2 cut(s) 143, 453
BcgI CGANNNNNNTGC 2 cut(s) 35, 69
BciT130I CCWGG 1 cut(s) 104
BfaI CTAG 1 cut(s) 206
BisI GCNGC 2 cut(s) 343, 439
BlsI GCNGC 2 cut(s) 344, 440
BmcAI AGTACT 1 cut(s) 357
Bme1390I CCNGG 1 cut(s) 104
BmiI GGNNCC 1 cut(s) 170
BmrFI CCNGG 1 cut(s) 104
BmrI ACTGGG 1 cut(s) 174
BmuI ACTGGG 1 cut(s) 174
Bpu10I CCTNAGC 1 cut(s) 65
BpuEI CTTGAG 2 cut(s) 107, 158
BsaWI WCCGGW 1 cut(s) 239
Bsc4I CCNNNNNNNGG 6 cut(s) 70, 165, 178, 211, 349, 401
Bse1I ACTGG 2 cut(s) 169, 216
Bse21I CCTNAGG 1 cut(s) 272
BseBI CCWGG 1 cut(s) 104
BseLI CCNNNNNNNGG 6 cut(s) 70, 165, 178, 211, 349, 401
BseMII CTCAG 2 cut(s) 286, 324
BseNI ACTGG 2 cut(s) 169, 216
BshFI GGCC 1 cut(s) 215
BsiHKAI GWGCWC 1 cut(s) 204
BsiSI CCGG 1 cut(s) 240
BslI CCNNNNNNNGG 6 cut(s) 70, 165, 178, 211, 349, 401
BsnI GGCC 1 cut(s) 215
Bsp1286I GDGCHC 1 cut(s) 204
Bsp143I GATC 3 cut(s) 132, 168, 367
BspACI CCGC 3 cut(s) 343, 439, 451
BspANI GGCC 1 cut(s) 215
BspCNI CTCAG 2 cut(s) 285, 325
BspLI GGNNCC 1 cut(s) 170
BspPI GGATC 4 cut(s) 127, 163, 176, 375
BsrI ACTGG 2 cut(s) 169, 216
BssMI GATC 3 cut(s) 132, 168, 367
Bst2UI CCWGG 1 cut(s) 104
Bst4CI ACNGT 2 cut(s) 314, 319
BstDEI CTNAG 4 cut(s) 65, 196, 272, 333
BstENI CCTNNNNNAGG 1 cut(s) 68
BstKTI GATC 3 cut(s) 135, 171, 370
BstMBI GATC 3 cut(s) 132, 168, 367
BstNI CCWGG 1 cut(s) 104
BstNSI RCATGY 1 cut(s) 410
BstSCI CCNGG 1 cut(s) 102
BstX2I RGATCY 1 cut(s) 168
BstYI RGATCY 1 cut(s) 168
Bsu36I CCTNAGG 1 cut(s) 272
BsuRI GGCC 1 cut(s) 215
Csp6I GTAC 2 cut(s) 315, 356
CviAII CATG 2 cut(s) 34, 407
CviJI RGCY 6 cut(s) 5, 175, 195, 215, 422, 433
CviKI_1 RGCY 6 cut(s) 5, 175, 195, 215, 422, 433
CviQI GTAC 2 cut(s) 315, 356
DdeI CTNAG 4 cut(s) 65, 196, 272, 333
DpnI GATC 3 cut(s) 134, 170, 369
DpnII GATC 3 cut(s) 132, 168, 367
Eco81I CCTNAGG 1 cut(s) 272
EcoNI CCTNNNNNAGG 1 cut(s) 68
EcoRII CCWGG 1 cut(s) 102
FaeI CATG 2 cut(s) 37, 410
FaiI YATR 5 cut(s) 24, 35, 374, 386, 408
FatI CATG 2 cut(s) 33, 406
FblI GTMKAC 1 cut(s) 75
Fnu4HI GCNGC 2 cut(s) 343, 439
Fsp4HI GCNGC 2 cut(s) 343, 439
FspBI CTAG 1 cut(s) 206
GluI GCNGC 2 cut(s) 343, 439
HaeIII GGCC 1 cut(s) 215
HapII CCGG 1 cut(s) 240
Hin1II CATG 2 cut(s) 37, 410
HincII GTYRAC 2 cut(s) 76, 184
HindII GTYRAC 2 cut(s) 76, 184
HinfI GANTC 2 cut(s) 99, 153
HpaII CCGG 1 cut(s) 240
HphI GGTGA 1 cut(s) 148
Hpy166II GTNNAC 2 cut(s) 76, 184
Hpy188I TCNGA 2 cut(s) 310, 458
Hpy188III TCNNGA 2 cut(s) 124, 256
Hpy8I GTNNAC 2 cut(s) 76, 184
HpyCH4III ACNGT 2 cut(s) 314, 319
HpyCH4V TGCA 2 cut(s) 40, 410
HpyF3I CTNAG 4 cut(s) 65, 196, 272, 333
Hsp92II CATG 2 cut(s) 37, 410
Kzo9I GATC 3 cut(s) 132, 168, 367
LpnPI CCDG 9 cut(s) 26, 89, 116, 150, 185, 197, 253, 259, 457
MaeI CTAG 1 cut(s) 206
MalI GATC 3 cut(s) 134, 170, 369
MboI GATC 3 cut(s) 132, 168, 367
MflI RGATCY 1 cut(s) 168
MhlI GDGCHC 1 cut(s) 204
MluCI AATT 5 cut(s) 28, 128, 227, 261, 278
MnlI CCTC 7 cut(s) 11, 131, 226, 236, 281, 456, 464
MseI TTAA 2 cut(s) 27, 281
MslI CAYNNNNRTG 1 cut(s) 147
MspI CCGG 1 cut(s) 240
MspR9I CCNGG 1 cut(s) 104
MvaI CCWGG 1 cut(s) 104
NdeII GATC 3 cut(s) 132, 168, 367
NlaIII CATG 2 cut(s) 37, 410
NlaIV GGNNCC 1 cut(s) 170
NspI RCATGY 1 cut(s) 410
PfeI GAWTC 2 cut(s) 99, 153
PflMI CCANNNNNTGG 1 cut(s) 178
PkrI GCNGC 2 cut(s) 344, 440
PshBI ATTAAT 1 cut(s) 27
Psp6I CCWGG 1 cut(s) 102
PspGI CCWGG 1 cut(s) 102
PspN4I GGNNCC 1 cut(s) 170
PsuI RGATCY 1 cut(s) 168
RsaI GTAC 2 cut(s) 316, 357
RsaNI GTAC 2 cut(s) 315, 356
RseI CAYNNNNRTG 1 cut(s) 147
SalI GTCGAC 1 cut(s) 74
SaqAI TTAA 2 cut(s) 27, 281
SatI GCNGC 2 cut(s) 343, 439
Sau3AI GATC 3 cut(s) 132, 168, 367
ScaI AGTACT 1 cut(s) 357
ScrFI CCNGG 1 cut(s) 104
SduI GDGCHC 1 cut(s) 204
SetI ASST 8 cut(s) 75, 177, 197, 207, 247, 380, 397, 467
SmiMI CAYNNNNRTG 1 cut(s) 147
SmlI CTYRAG 2 cut(s) 122, 137
SmoI CTYRAG 2 cut(s) 122, 137
Sse9I AATT 5 cut(s) 28, 128, 227, 261, 278
SsiI CCGC 3 cut(s) 343, 439, 451
SspMI CTAG 1 cut(s) 206
StyD4I CCNGG 1 cut(s) 102
TaaI ACNGT 2 cut(s) 314, 319
TaqI TCGA 1 cut(s) 75
TasI AATT 5 cut(s) 28, 128, 227, 261, 278
TatI WGTACW 1 cut(s) 355
TauI GCSGC 2 cut(s) 345, 441
TfiI GAWTC 2 cut(s) 99, 153
Tru1I TTAA 2 cut(s) 27, 281
Tru9I TTAA 2 cut(s) 27, 281
TspDTI ATGAA 1 cut(s) 405
Van91I CCANNNNNTGG 1 cut(s) 178
VspI ATTAAT 1 cut(s) 27
XagI CCTNNNNNAGG 1 cut(s) 68
XceI RCATGY 1 cut(s) 410
XmiI GTMKAC 1 cut(s) 75
XspI CTAG 1 cut(s) 206
ZrmI AGTACT 1 cut(s) 357
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.