FvH4_5g26670

Belongs to the adaptor complexes small subunit family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
OG0004589
Physical Location & Seq
Forward (+)
18114894 .. 18123370
8477 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g26670.t1

Sequence Viewer

Length: 423 bp
ATGCTTGCAAGCTTTTGTGGAAAAAAGGTAATGAGGGAGCTTAGTGGTGTAATACTCAACCGAGGCTCCAAGTTATGCAACTTCATAGAATGGAGGGGGCTTAAAGTTGTCTATAAAAGATACGCGAGCCTCTATTTCTACATGTGCATTGACCAAGAGGACAATGAATTAGAGGTTCTTGAAATAATTCACCAATATGTTGAGATACTCGATCGATATTTTGGCAGTGTTTGTGAGCTGGATTTGATTTTTAATTTTCACAAGGCTTACTTTATATTGGATGAACTTCTACTTGCTGGTGAGCTTCAAGACTCGAGTAAGAGAGCAGTGGGACACATGATAGCTATACATGATCGATTTGTGGAGGCGGTTAAAGAGGAGGCCAATTCAATAAGCAATTTAATTGCACAAGTCAATATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04142 map04142
Pfam Domains
Protein Families
Clat_adaptor_s

Protein Analysis

141

Amino Acids

16.25

Weight (kDa)

5.35

Isoelectric Point (pI)

33.63

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Clat_adaptor_s PF01217 8 - 119 3.1e-42 Clathrin adaptor complex small chain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 125
AciI CCGC 1 cut(s) 368
AflIII ACRYGT 1 cut(s) 141
AgsI TTSAA 3 cut(s) 182, 308, 390
AluBI AGCT 5 cut(s) 12, 40, 238, 304, 344
AluI AGCT 5 cut(s) 12, 40, 238, 304, 344
Ama87I CYCGRG 1 cut(s) 313
AoxI GGCC 1 cut(s) 381
Asp700I GAANNNNTTC 1 cut(s) 186
AsuHPI GGTGA 2 cut(s) 182, 311
AvaI CYCGRG 1 cut(s) 313
BmeT110I CYCGRG 1 cut(s) 313
BmiI GGNNCC 1 cut(s) 67
Bsa29I ATCGAT 2 cut(s) 214, 355
BsaJI CCNNGG 1 cut(s) 61
BsaXI ACNNNNNCTCC 2 cut(s) 50, 80
BseCI ATCGAT 2 cut(s) 214, 355
BseDI CCNNGG 1 cut(s) 61
BseGI GGATG 1 cut(s) 286
BseRI GAGGAG 1 cut(s) 392
Bsh1236I CGCG 1 cut(s) 125
Bsh1285I CGRYCG 1 cut(s) 214
BshFI GGCC 1 cut(s) 383
BshVI ATCGAT 2 cut(s) 214, 355
BsiEI CGRYCG 1 cut(s) 214
BsiHKCI CYCGRG 1 cut(s) 313
BslFI GGGAC 1 cut(s) 345
BsmFI GGGAC 1 cut(s) 345
BsnI GGCC 1 cut(s) 383
BsoBI CYCGRG 1 cut(s) 313
Bsp143I GATC 2 cut(s) 211, 352
BspACI CCGC 1 cut(s) 368
BspANI GGCC 1 cut(s) 383
BspDI ATCGAT 2 cut(s) 214, 355
BspFNI CGCG 1 cut(s) 125
BspLI GGNNCC 1 cut(s) 67
BssECI CCNNGG 1 cut(s) 61
BssMI GATC 2 cut(s) 211, 352
BstC8I GCNNGC 3 cut(s) 6, 10, 127
BstDEI CTNAG 1 cut(s) 41
BstF5I GGATG 1 cut(s) 286
BstFNI CGCG 1 cut(s) 125
BstKTI GATC 2 cut(s) 214, 355
BstMBI GATC 2 cut(s) 211, 352
BstMCI CGRYCG 1 cut(s) 214
BstNSI RCATGY 1 cut(s) 145
BstUI CGCG 1 cut(s) 125
Bsu15I ATCGAT 2 cut(s) 214, 355
BsuRI GGCC 1 cut(s) 383
BsuTUI ATCGAT 2 cut(s) 214, 355
BtsCI GGATG 1 cut(s) 286
BtsI GCAGTG 2 cut(s) 232, 333
BtsIMutI CAGTG 2 cut(s) 232, 333
Cac8I GCNNGC 3 cut(s) 6, 10, 127
ClaI ATCGAT 2 cut(s) 214, 355
CviAII CATG 3 cut(s) 142, 337, 350
DdeI CTNAG 1 cut(s) 41
DpnI GATC 2 cut(s) 213, 354
DpnII GATC 2 cut(s) 211, 352
Eco88I CYCGRG 1 cut(s) 313
FaeI CATG 3 cut(s) 145, 340, 353
FalI AAGNNNNNCTT 2 cut(s) 254, 286
FaqI GGGAC 1 cut(s) 345
FatI CATG 3 cut(s) 141, 336, 349
FokI GGATG 1 cut(s) 293
HaeIII GGCC 1 cut(s) 383
Hin1II CATG 3 cut(s) 145, 340, 353
HindIII AAGCTT 1 cut(s) 10
HinfI GANTC 1 cut(s) 311
HphI GGTGA 2 cut(s) 182, 311
Hpy188III TCNNGA 2 cut(s) 179, 308
HpyCH4V TGCA 4 cut(s) 8, 78, 147, 407
HpyF3I CTNAG 1 cut(s) 41
Hsp92II CATG 3 cut(s) 145, 340, 353
Kzo9I GATC 2 cut(s) 211, 352
LmnI GCTCC 2 cut(s) 37, 71
LpnPI CCDG 2 cut(s) 224, 282
MalI GATC 2 cut(s) 213, 354
MboI GATC 2 cut(s) 211, 352
MluCI AATT 6 cut(s) 167, 186, 253, 385, 397, 402
MlyI GAGTC 1 cut(s) 305
MnlI CCTC 9 cut(s) 27, 56, 87, 140, 151, 166, 358, 370, 373
MroXI GAANNNNTTC 1 cut(s) 186
MseI TTAA 4 cut(s) 102, 252, 372, 401
MslI CAYNNNNRTG 1 cut(s) 195
MvnI CGCG 1 cut(s) 125
NdeII GATC 2 cut(s) 211, 352
NlaIII CATG 3 cut(s) 145, 340, 353
NlaIV GGNNCC 1 cut(s) 67
NspI RCATGY 1 cut(s) 145
PaeR7I CTCGAG 1 cut(s) 313
PciI ACATGT 1 cut(s) 141
PdmI GAANNNNTTC 1 cut(s) 186
Ple19I CGATCG 1 cut(s) 214
PleI GAGTC 1 cut(s) 305
PpsI GAGTC 1 cut(s) 305
PscI ACATGT 1 cut(s) 141
PspN4I GGNNCC 1 cut(s) 67
PspXI VCTCGAGB 1 cut(s) 313
PvuI CGATCG 1 cut(s) 214
RseI CAYNNNNRTG 1 cut(s) 195
SaqAI TTAA 4 cut(s) 102, 252, 372, 401
Sau3AI GATC 2 cut(s) 211, 352
SchI GAGTC 1 cut(s) 305
SetI ASST 7 cut(s) 14, 30, 42, 177, 240, 306, 346
Sfr274I CTCGAG 1 cut(s) 313
SlaI CTCGAG 1 cut(s) 313
SmiMI CAYNNNNRTG 1 cut(s) 195
SmlI CTYRAG 1 cut(s) 313
SmoI CTYRAG 1 cut(s) 313
Sse9I AATT 6 cut(s) 167, 186, 253, 385, 397, 402
SsiI CCGC 1 cut(s) 368
TaqI TCGA 4 cut(s) 210, 214, 314, 355
TasI AATT 6 cut(s) 167, 186, 253, 385, 397, 402
Tru1I TTAA 4 cut(s) 102, 252, 372, 401
Tru9I TTAA 4 cut(s) 102, 252, 372, 401
TscAI CASTG 2 cut(s) 232, 333
TspDTI ATGAA 3 cut(s) 73, 180, 297
TspRI CASTG 2 cut(s) 232, 333
XceI RCATGY 1 cut(s) 145
XhoI CTCGAG 1 cut(s) 313
XmnI GAANNNNTTC 1 cut(s) 186
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.