FvH4_5g29781

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
Physical Location & Seq
Reverse (-)
20687057 .. 20688695
1639 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g29781.t1

Sequence Viewer

Length: 156 bp
ATGGACAAAGCATATTGCTTCCCTAATTCCCTTGCTCATCAGTCAGTCCCTGCTCATCTCCTCCAGTCCTCCATTCGTCGATTGCAGGGACAAGGGGTTGTGGAAGTAGCAGAGGTGAGAGCAGAATCAAGTACATTCGTTAACGGAGGAATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

5.5

Weight (kDa)

6.7

Isoelectric Point (pI)

68.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 133
AlwNI CAGNNNCTG 1 cut(s) 50
AsuHPI GGTGA 1 cut(s) 127
BfaI CTAG 1 cut(s) 154
BpmI CTGGAG 1 cut(s) 47
Bse1I ACTGG 1 cut(s) 64
BseNI ACTGG 1 cut(s) 64
BseRI GAGGAG 1 cut(s) 50
BslFI GGGAC 2 cut(s) 32, 102
BsmFI GGGAC 2 cut(s) 32, 102
BsrI ACTGG 1 cut(s) 64
CaiI CAGNNNCTG 1 cut(s) 50
Csp6I GTAC 1 cut(s) 132
CviQI GTAC 1 cut(s) 132
FaiI YATR 1 cut(s) 13
FaqI GGGAC 2 cut(s) 32, 102
FspBI CTAG 1 cut(s) 154
GsuI CTGGAG 1 cut(s) 47
HincII GTYRAC 1 cut(s) 142
HindII GTYRAC 1 cut(s) 142
HinfI GANTC 2 cut(s) 125, 150
HpaI GTTAAC 1 cut(s) 142
HphI GGTGA 1 cut(s) 127
Hpy166II GTNNAC 1 cut(s) 142
Hpy8I GTNNAC 1 cut(s) 142
Hpy99I CGWCG 1 cut(s) 81
HpyCH4V TGCA 1 cut(s) 85
KspAI GTTAAC 1 cut(s) 142
LpnPI CCDG 3 cut(s) 63, 71, 77
MaeI CTAG 1 cut(s) 154
MluCI AATT 1 cut(s) 25
MnlI CCTC 4 cut(s) 71, 79, 106, 140
MseI TTAA 1 cut(s) 141
PfeI GAWTC 2 cut(s) 125, 150
PstNI CAGNNNCTG 1 cut(s) 50
RsaI GTAC 1 cut(s) 133
RsaNI GTAC 1 cut(s) 132
SaqAI TTAA 1 cut(s) 141
SetI ASST 1 cut(s) 117
SgeI CNNG 6 cut(s) 44, 62, 76, 98, 104, 141
Sse9I AATT 1 cut(s) 25
SspMI CTAG 1 cut(s) 154
TaqI TCGA 1 cut(s) 79
TasI AATT 1 cut(s) 25
TatI WGTACW 1 cut(s) 131
TfiI GAWTC 2 cut(s) 125, 150
Tru1I TTAA 1 cut(s) 141
Tru9I TTAA 1 cut(s) 141
XspI CTAG 1 cut(s) 154
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.