FvH4_5g31050

RNA-binding protein

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
Physical Location & Seq
Forward (+)
21970909 .. 21973053
2145 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g31050.t1

Sequence Viewer

Length: 213 bp
ATGAAGGAAGTTGGGGATGAGATTAGTCAAGTTAAGAATCATACTGAGGTAGTACAAATAACTGGAGTTGTAATGTTGTCAGAGTCAAGAGGACTGGCAAAACTAAAGGATTTGTATTTGTTAGTTAACCCTTTAGACCTGGCTGGAGCGAGCAAGGAAATGAATGGAAAATACGTGGGGAATCGGCCTATTAAACTGCGTAAAAGTAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

7.72

Weight (kDa)

9.4

Isoelectric Point (pI)

13.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 54
AjnI CCWGG 1 cut(s) 138
AoxI GGCC 1 cut(s) 185
BciT130I CCWGG 1 cut(s) 140
BfaI CTAG 1 cut(s) 211
Bme1390I CCNGG 1 cut(s) 140
BmrFI CCNGG 1 cut(s) 140
BpmI CTGGAG 2 cut(s) 84, 165
BsaAI YACGTR 1 cut(s) 175
Bse1I ACTGG 2 cut(s) 67, 99
BseBI CCWGG 1 cut(s) 140
BseGI GGATG 1 cut(s) 22
BseMII CTCAG 1 cut(s) 36
BseNI ACTGG 2 cut(s) 67, 99
BshFI GGCC 1 cut(s) 187
BsnI GGCC 1 cut(s) 187
BspANI GGCC 1 cut(s) 187
BspCNI CTCAG 1 cut(s) 37
BsrI ACTGG 2 cut(s) 67, 99
Bst2UI CCWGG 1 cut(s) 140
BstBAI YACGTR 1 cut(s) 175
BstC8I GCNNGC 1 cut(s) 151
BstDEI CTNAG 1 cut(s) 45
BstF5I GGATG 1 cut(s) 22
BstNI CCWGG 1 cut(s) 140
BstSCI CCNGG 1 cut(s) 138
BsuRI GGCC 1 cut(s) 187
BtsCI GGATG 1 cut(s) 22
Cac8I GCNNGC 1 cut(s) 151
Csp6I GTAC 1 cut(s) 53
CviJI RGCY 2 cut(s) 143, 187
CviKI_1 RGCY 2 cut(s) 143, 187
CviQI GTAC 1 cut(s) 53
DdeI CTNAG 1 cut(s) 45
EcoRII CCWGG 1 cut(s) 138
FaiI YATR 1 cut(s) 42
FokI GGATG 1 cut(s) 29
FspBI CTAG 1 cut(s) 211
GsuI CTGGAG 2 cut(s) 84, 165
HaeIII GGCC 1 cut(s) 187
HincII GTYRAC 1 cut(s) 127
HindII GTYRAC 1 cut(s) 127
HinfI GANTC 3 cut(s) 37, 83, 181
HpaI GTTAAC 1 cut(s) 127
Hpy166II GTNNAC 1 cut(s) 127
Hpy188I TCNGA 1 cut(s) 82
Hpy188III TCNNGA 1 cut(s) 87
Hpy8I GTNNAC 1 cut(s) 127
HpyCH4IV ACGT 1 cut(s) 174
HpyF3I CTNAG 1 cut(s) 45
HpySE526I ACGT 1 cut(s) 174
KspAI GTTAAC 1 cut(s) 127
LmnI GCTCC 1 cut(s) 146
LpnPI CCDG 5 cut(s) 48, 80, 125, 129, 152
MaeI CTAG 1 cut(s) 211
MaeII ACGT 1 cut(s) 174
MaeIII GTNAC 1 cut(s) 206
MlyI GAGTC 1 cut(s) 92
MnlI CCTC 2 cut(s) 40, 83
MseI TTAA 3 cut(s) 33, 126, 192
MspR9I CCNGG 1 cut(s) 140
MvaI CCWGG 1 cut(s) 140
PfeI GAWTC 2 cut(s) 37, 181
PleI GAGTC 1 cut(s) 91
PpsI GAGTC 1 cut(s) 91
Ppu21I YACGTR 1 cut(s) 175
Psp6I CCWGG 1 cut(s) 138
PspGI CCWGG 1 cut(s) 138
RsaI GTAC 1 cut(s) 54
RsaNI GTAC 1 cut(s) 53
SaqAI TTAA 3 cut(s) 33, 126, 192
SchI GAGTC 1 cut(s) 92
ScrFI CCNGG 1 cut(s) 140
SetI ASST 3 cut(s) 51, 141, 177
SspMI CTAG 1 cut(s) 211
StyD4I CCNGG 1 cut(s) 138
TaiI ACGT 1 cut(s) 177
TatI WGTACW 1 cut(s) 52
TfiI GAWTC 2 cut(s) 37, 181
Tru1I TTAA 3 cut(s) 33, 126, 192
Tru9I TTAA 3 cut(s) 33, 126, 192
TspDTI ATGAA 2 cut(s) 17, 176
XspI CTAG 1 cut(s) 211
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.