MD12G1247100.v1.1

RNA-binding protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr12
OG0006115
Physical Location & Seq
Forward (+)
31733599 .. 31734753
1155 bp
Loading structure...
UTR
Exon/CDS
Intron
MD12G1247100.v1.1.491

Sequence Viewer

Length: 273 bp
ATGTTCTCATTTTTGTGTGATATTTGGTTGGTAAGAGTTGTCAGAGATAAGAGGACTGGAAAAACCAAGGGCTTTGGATTTGTTAGCTTTGCCAACCCATCTGACCTGGCCGGAGCACTAAAGGAAATGAATGGTAAGTATGTGGGCAATCGGCCAATCAAACTACGCAAAAGTAACTGGAGGGAGAGGATAGATTATGACGCACTAGAAAGACAAAAGAACCACACTCACAAGAAACCAAAGCCTTCGAAGAAGAGTATATTGCACAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RRM_1

Protein Analysis

91

Amino Acids

10.52

Weight (kDa)

10.45

Isoelectric Point (pI)

21.72

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RRM_1 PF00076 11 - 54 2.9e-12 RNA recognition motif
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 2 cut(s) 108, 152
AjnI CCWGG 1 cut(s) 105
AluBI AGCT 1 cut(s) 87
AluI AGCT 1 cut(s) 87
Alw21I GWGCWC 1 cut(s) 118
AoxI GGCC 2 cut(s) 108, 152
AsuII TTCGAA 1 cut(s) 248
Bbv12I GWGCWC 1 cut(s) 118
BccI CCATC 1 cut(s) 106
BciT130I CCWGG 1 cut(s) 107
BfaI CTAG 1 cut(s) 206
Bme1390I CCNGG 1 cut(s) 107
BmrFI CCNGG 1 cut(s) 107
BpmI CTGGAG 1 cut(s) 199
Bpu14I TTCGAA 1 cut(s) 248
BsaJI CCNNGG 1 cut(s) 66
Bse1I ACTGG 2 cut(s) 61, 182
BseBI CCWGG 1 cut(s) 107
BseDI CCNNGG 1 cut(s) 66
BseNI ACTGG 2 cut(s) 61, 182
BshFI GGCC 2 cut(s) 110, 154
BsiHKAI GWGCWC 1 cut(s) 118
BsiSI CCGG 1 cut(s) 111
BsnI GGCC 2 cut(s) 110, 154
Bsp119I TTCGAA 1 cut(s) 248
Bsp1286I GDGCHC 1 cut(s) 118
BspANI GGCC 2 cut(s) 110, 154
BspT104I TTCGAA 1 cut(s) 248
BsrI ACTGG 2 cut(s) 61, 182
BssECI CCNNGG 1 cut(s) 66
BssT1I CCWWGG 1 cut(s) 66
Bst2UI CCWGG 1 cut(s) 107
Bst6I CTCTTC 1 cut(s) 248
BstBI TTCGAA 1 cut(s) 248
BstNI CCWGG 1 cut(s) 107
BstSCI CCNGG 1 cut(s) 105
BsuRI GGCC 2 cut(s) 110, 154
CseI GACGC 1 cut(s) 209
CviJI RGCY 5 cut(s) 72, 87, 110, 154, 244
CviKI_1 RGCY 5 cut(s) 72, 87, 110, 154, 244
EaeI YGGCCR 2 cut(s) 108, 152
Eam1104I CTCTTC 1 cut(s) 248
EarI CTCTTC 1 cut(s) 248
Eco130I CCWWGG 1 cut(s) 66
EcoRII CCWGG 1 cut(s) 105
EcoT14I CCWWGG 1 cut(s) 66
ErhI CCWWGG 1 cut(s) 66
FaiI YATR 3 cut(s) 141, 198, 260
FspBI CTAG 1 cut(s) 206
GsuI CTGGAG 1 cut(s) 199
HaeIII GGCC 2 cut(s) 110, 154
HapII CCGG 1 cut(s) 111
HgaI GACGC 1 cut(s) 209
HpaII CCGG 1 cut(s) 111
Hpy188I TCNGA 2 cut(s) 44, 103
HpyAV CCTTC 1 cut(s) 255
HpyCH4V TGCA 1 cut(s) 265
LmnI GCTCC 1 cut(s) 113
LpnPI CCDG 5 cut(s) 42, 92, 119, 124, 163
MaeI CTAG 1 cut(s) 206
MaeIII GTNAC 1 cut(s) 173
MboII GAAGA 2 cut(s) 262, 265
MhlI GDGCHC 1 cut(s) 118
MnlI CCTC 3 cut(s) 45, 174, 180
MslI CAYNNNNRTG 1 cut(s) 13
MspI CCGG 1 cut(s) 111
MspR9I CCNGG 1 cut(s) 107
MvaI CCWGG 1 cut(s) 107
NspV TTCGAA 1 cut(s) 248
Psp6I CCWGG 1 cut(s) 105
PspGI CCWGG 1 cut(s) 105
RseI CAYNNNNRTG 1 cut(s) 13
ScrFI CCNGG 1 cut(s) 107
SduI GDGCHC 1 cut(s) 118
SetI ASST 2 cut(s) 89, 108
SfuI TTCGAA 1 cut(s) 248
SgeI CNNG 8 cut(s) 69, 79, 118, 119, 123, 190, 218, 244
SmiMI CAYNNNNRTG 1 cut(s) 13
SspMI CTAG 1 cut(s) 206
StyD4I CCNGG 1 cut(s) 105
StyI CCWWGG 1 cut(s) 66
TaqI TCGA 1 cut(s) 248
TspDTI ATGAA 1 cut(s) 143
XspI CTAG 1 cut(s) 206
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.