Rmu_ssc0000031.1_g000001

RNA-binding protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000031.1
OG0006115
Physical Location & Seq
Forward (+)
1 .. 750
750 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000031.1_g000001.1.cds

Sequence Viewer

Length: 178 bp
cccttcagacctggctggagcactcaaggaaatgaatggcaagtatgtggggaatcggcctattaaactgcgcaaaagtaactggagggagcggatagattatgatgcattagagaaacaaaagaacttctcgcataagaagccgaagctttcaaagaagagtatattacacaaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RRM_1

Protein Analysis

58

Amino Acids

6.79

Weight (kDa)

10.25

Isoelectric Point (pI)

19.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 72
AccBSI CCGCTC 1 cut(s) 92
AciI CCGC 1 cut(s) 92
AgsI TTSAA 1 cut(s) 154
AjnI CCWGG 1 cut(s) 10
AluBI AGCT 1 cut(s) 149
AluI AGCT 1 cut(s) 149
Alw21I GWGCWC 1 cut(s) 23
AoxI GGCC 1 cut(s) 57
AspLEI GCGC 1 cut(s) 73
Bbv12I GWGCWC 1 cut(s) 23
BciT130I CCWGG 1 cut(s) 12
Bme1390I CCNGG 1 cut(s) 12
BmrFI CCNGG 1 cut(s) 12
BmsI GCATC 1 cut(s) 95
BpmI CTGGAG 2 cut(s) 37, 104
BpuEI CTTGAG 1 cut(s) 9
Bse1I ACTGG 1 cut(s) 87
BseBI CCWGG 1 cut(s) 12
BseNI ACTGG 1 cut(s) 87
BshFI GGCC 1 cut(s) 59
BsiHKAI GWGCWC 1 cut(s) 23
BsnI GGCC 1 cut(s) 59
Bsp1286I GDGCHC 1 cut(s) 23
BspACI CCGC 1 cut(s) 92
BspANI GGCC 1 cut(s) 59
BsrBI CCGCTC 1 cut(s) 92
BsrI ACTGG 1 cut(s) 87
Bst2UI CCWGG 1 cut(s) 12
Bst6I CTCTTC 1 cut(s) 153
BstHHI GCGC 1 cut(s) 73
BstMWI GCNNNNNNNGC 1 cut(s) 140
BstNI CCWGG 1 cut(s) 12
BstSCI CCNGG 1 cut(s) 10
BsuRI GGCC 1 cut(s) 59
CfoI GCGC 1 cut(s) 73
CviJI RGCY 4 cut(s) 15, 59, 143, 149
CviKI_1 RGCY 4 cut(s) 15, 59, 143, 149
Eam1104I CTCTTC 1 cut(s) 153
EarI CTCTTC 1 cut(s) 153
EcoRII CCWGG 1 cut(s) 10
EcoT22I ATGCAT 1 cut(s) 110
FaiI YATR 4 cut(s) 46, 103, 136, 165
FspI TGCGCA 1 cut(s) 72
GlaI GCGC 1 cut(s) 72
GsuI CTGGAG 2 cut(s) 37, 104
HaeIII GGCC 1 cut(s) 59
HhaI GCGC 1 cut(s) 73
Hin6I GCGC 1 cut(s) 71
HinP1I GCGC 1 cut(s) 71
HindIII AAGCTT 1 cut(s) 147
HinfI GANTC 1 cut(s) 53
Hpy188I TCNGA 1 cut(s) 8
HpyAV CCTTC 1 cut(s) 13
HpyCH4V TGCA 1 cut(s) 108
HpyF10VI GCNNNNNNNGC 1 cut(s) 140
HspAI GCGC 1 cut(s) 71
LmnI GCTCC 2 cut(s) 18, 89
LpnPI CCDG 2 cut(s) 24, 68
LweI GCATC 1 cut(s) 95
MaeIII GTNAC 1 cut(s) 78
MbiI CCGCTC 1 cut(s) 92
MboII GAAGA 1 cut(s) 170
MhlI GDGCHC 1 cut(s) 23
MnlI CCTC 1 cut(s) 79
Mph1103I ATGCAT 1 cut(s) 110
MseI TTAA 1 cut(s) 64
MspR9I CCNGG 1 cut(s) 12
MvaI CCWGG 1 cut(s) 12
MwoI GCNNNNNNNGC 1 cut(s) 140
NsbI TGCGCA 1 cut(s) 72
NsiI ATGCAT 1 cut(s) 110
PfeI GAWTC 1 cut(s) 53
Psp6I CCWGG 1 cut(s) 10
PspGI CCWGG 1 cut(s) 10
SaqAI TTAA 1 cut(s) 64
ScrFI CCNGG 1 cut(s) 12
SduI GDGCHC 1 cut(s) 23
SetI ASST 2 cut(s) 13, 151
SfaNI GCATC 1 cut(s) 95
SgeI CNNG 7 cut(s) 23, 24, 28, 38, 53, 95, 143
SmlI CTYRAG 1 cut(s) 24
SmoI CTYRAG 1 cut(s) 24
SsiI CCGC 1 cut(s) 92
StyD4I CCNGG 1 cut(s) 10
TfiI GAWTC 1 cut(s) 53
Tru1I TTAA 1 cut(s) 64
Tru9I TTAA 1 cut(s) 64
TspDTI ATGAA 1 cut(s) 48
Zsp2I ATGCAT 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.