FvH4_6g22620

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
Physical Location & Seq
Forward (+)
16257081 .. 16259073
1993 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g22620.t1

Sequence Viewer

Length: 183 bp
ATGGAAATAAAGTCCATCCTTGATGAACCTATCAAATCTCTTGGATTCCGACAAAGTGGGAGTAAGCGGAAAAACAAGCCTCACCGAGCTGCTGAAGCTGAGGTGTTTGGGGATTGGCAGTTGTTGCAGCTGATAATCAAGGATACTCAAAGACTCAACAAAATCAGGACTCACAAACTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

7.01

Weight (kDa)

10.2

Isoelectric Point (pI)

40.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 67
AcuI CTGAAG 1 cut(s) 114
AluBI AGCT 3 cut(s) 89, 98, 130
AluI AGCT 3 cut(s) 89, 98, 130
ApeKI GCWGC 2 cut(s) 89, 127
AsuHPI GGTGA 1 cut(s) 74
BbvCI CCTCAGC 1 cut(s) 99
BbvI GCAGC 2 cut(s) 76, 139
BccI CCATC 1 cut(s) 23
BciVI GTATCC 1 cut(s) 136
BfuI GTATCC 1 cut(s) 136
BisI GCNGC 2 cut(s) 90, 128
BlsI GCNGC 2 cut(s) 91, 129
Bpu10I CCTNAGC 1 cut(s) 99
BseGI GGATG 1 cut(s) 15
BseMII CTCAG 1 cut(s) 90
BseXI GCAGC 2 cut(s) 76, 139
BspACI CCGC 1 cut(s) 67
BspCNI CTCAG 1 cut(s) 91
BstAPI GCANNNNNTGC 1 cut(s) 124
BstDEI CTNAG 1 cut(s) 99
BstF5I GGATG 1 cut(s) 15
BstMWI GCNNNNNNNGC 2 cut(s) 95, 124
BstV1I GCAGC 2 cut(s) 76, 139
BsuI GTATCC 1 cut(s) 136
BtsCI GGATG 1 cut(s) 15
CviJI RGCY 4 cut(s) 79, 89, 98, 130
CviKI_1 RGCY 4 cut(s) 79, 89, 98, 130
DdeI CTNAG 1 cut(s) 99
Eco57I CTGAAG 1 cut(s) 114
Fnu4HI GCNGC 2 cut(s) 90, 128
FokI GGATG 1 cut(s) 2
Fsp4HI GCNGC 2 cut(s) 90, 128
GluI GCNGC 2 cut(s) 90, 128
HinfI GANTC 3 cut(s) 45, 153, 169
HphI GGTGA 1 cut(s) 74
Hpy188I TCNGA 1 cut(s) 50
Hpy188III TCNNGA 1 cut(s) 166
HpyCH4V TGCA 1 cut(s) 127
HpyF10VI GCNNNNNNNGC 2 cut(s) 95, 124
HpyF3I CTNAG 1 cut(s) 99
LpnPI CCDG 1 cut(s) 151
Lsp1109I GCAGC 2 cut(s) 76, 139
MlyI GAGTC 2 cut(s) 147, 163
MmeI TCCRAC 1 cut(s) 73
MnlI CCTC 2 cut(s) 90, 94
MseI TTAA 1 cut(s) 181
MspA1I CMGCKG 1 cut(s) 130
MwoI GCNNNNNNNGC 2 cut(s) 95, 124
PfeI GAWTC 1 cut(s) 45
PkrI GCNGC 2 cut(s) 91, 129
PleI GAGTC 2 cut(s) 147, 163
PpsI GAGTC 2 cut(s) 147, 163
PvuII CAGCTG 1 cut(s) 130
SaqAI TTAA 1 cut(s) 181
SatI GCNGC 2 cut(s) 90, 128
SchI GAGTC 2 cut(s) 147, 163
SetI ASST 5 cut(s) 31, 91, 100, 105, 132
SgeI CNNG 6 cut(s) 32, 53, 88, 98, 151, 178
SsiI CCGC 1 cut(s) 67
TfiI GAWTC 1 cut(s) 45
Tru1I TTAA 1 cut(s) 181
Tru9I TTAA 1 cut(s) 181
TseI GCWGC 2 cut(s) 89, 127
TspDTI ATGAA 1 cut(s) 39
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.