FvH4_7g13511

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb7
OG0004867
Physical Location & Seq
Reverse (-)
12109050 .. 12111360
2311 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_7g13511.t1

Sequence Viewer

Length: 513 bp
ATGGAGAATAAGAACTCGTCAGGCCCAATTCCTGATGGCTGGGAGGCTAAGACTGAACAGCAAAAGGATGGATCGGAAGTCCAGTGCTACTGGTGTCCCAGAAATGGTCAGCACTTTTTCACATATGCTGATATGATGCGCTATATAGCATATGCTCAGAATGACAAGCTTTCAATATACTCCCCAGATTTTCAGACCGTTAAGCTCAGAAAAAAAGCTAATTGGTCCCAGAAGGGGAACAGAACTATAGTTACTCCTAGGAGATGTTACTTTCTGGGGGAGAGTTCAAAGACACTGCCTTCTTATCGAGTAACTTCTACCGAGGAAAGCTCCGACTTAGAGGAAAGGACTACCCCGTCTGACCCTGAGGACAGCACTGAATCTACTGATACAGGGAAGAATATGGAAGCTGGTCAGGCTGGGATTGACAAAACCAAAATTCCGAACAGTGAGCTTGGTAAATGGGATGAAGATGAGTTTAGCATTTTCTCAGATTTCTCTAATAATGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
MBD

Protein Analysis

171

Amino Acids

19.42

Weight (kDa)

4.8

Isoelectric Point (pI)

34.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 355
AclWI GGATC 1 cut(s) 79
AcsI RAATTY 1 cut(s) 438
AfiI CCNNNNNNNGG 2 cut(s) 104, 234
AgsI TTSAA 2 cut(s) 174, 288
AluBI AGCT 6 cut(s) 169, 205, 218, 330, 410, 454
AluI AGCT 6 cut(s) 169, 205, 218, 330, 410, 454
AlwI GGATC 1 cut(s) 79
AoxI GGCC 1 cut(s) 22
ApoI RAATTY 1 cut(s) 438
AspA2I CCTAGG 1 cut(s) 257
AspLEI GCGC 1 cut(s) 141
AspS9I GGNCC 2 cut(s) 23, 225
AvaII GGWCC 1 cut(s) 225
AvrII CCTAGG 1 cut(s) 257
AxyI CCTNAGG 1 cut(s) 366
BccI CCATC 2 cut(s) 29, 62
BfaI CTAG 1 cut(s) 258
BfmI CTRYAG 1 cut(s) 246
BlnI CCTAGG 1 cut(s) 257
Bme18I GGWCC 1 cut(s) 225
BmgT120I GGNCC 2 cut(s) 23, 225
BmiI GGNNCC 1 cut(s) 227
BmsI GCATC 1 cut(s) 126
BplI GAGNNNNNCTC 2 cut(s) 314, 346
BsaJI CCNNGG 2 cut(s) 257, 321
Bsc4I CCNNNNNNNGG 2 cut(s) 104, 234
Bse1I ACTGG 2 cut(s) 82, 95
Bse21I CCTNAGG 1 cut(s) 366
BseDI CCNNGG 2 cut(s) 257, 321
BseGI GGATG 2 cut(s) 73, 472
BseLI CCNNNNNNNGG 2 cut(s) 104, 234
BseMII CTCAG 4 cut(s) 170, 220, 357, 504
BseNI ACTGG 2 cut(s) 82, 95
BseYI CCCAGC 2 cut(s) 39, 419
BshFI GGCC 1 cut(s) 24
BslFI GGGAC 2 cut(s) 81, 211
BslI CCNNNNNNNGG 2 cut(s) 104, 234
BsmFI GGGAC 2 cut(s) 81, 211
BsnI GGCC 1 cut(s) 24
Bsp143I GATC 1 cut(s) 71
BspANI GGCC 1 cut(s) 24
BspCNI CTCAG 4 cut(s) 169, 219, 358, 503
BspLI GGNNCC 1 cut(s) 227
BspPI GGATC 1 cut(s) 79
BsrI ACTGG 2 cut(s) 82, 95
BssECI CCNNGG 2 cut(s) 257, 321
BssMI GATC 1 cut(s) 71
BssT1I CCWWGG 1 cut(s) 257
Bst4CI ACNGT 2 cut(s) 199, 449
BstDEI CTNAG 6 cut(s) 48, 156, 206, 337, 366, 490
BstF5I GGATG 2 cut(s) 73, 472
BstHHI GCGC 1 cut(s) 141
BstKTI GATC 1 cut(s) 74
BstMBI GATC 1 cut(s) 71
BstMWI GCNNNNNNNGC 1 cut(s) 416
BstSFI CTRYAG 1 cut(s) 246
Bsu36I CCTNAGG 1 cut(s) 366
BsuRI GGCC 1 cut(s) 24
BtsCI GGATG 2 cut(s) 73, 472
BtsI GCAGTG 1 cut(s) 293
BtsIMutI CAGTG 4 cut(s) 89, 293, 375, 454
CfoI GCGC 1 cut(s) 141
Cfr13I GGNCC 2 cut(s) 23, 225
DdeI CTNAG 6 cut(s) 48, 156, 206, 337, 366, 490
DpnI GATC 1 cut(s) 73
DpnII GATC 1 cut(s) 71
DrdI GACNNNNNNGTC 1 cut(s) 355
DseDI GACNNNNNNGTC 1 cut(s) 355
Eco130I CCWWGG 1 cut(s) 257
Eco47I GGWCC 1 cut(s) 225
Eco81I CCTNAGG 1 cut(s) 366
EcoT14I CCWWGG 1 cut(s) 257
ErhI CCWWGG 1 cut(s) 257
FaqI GGGAC 2 cut(s) 81, 211
FauNDI CATATG 2 cut(s) 124, 151
FokI GGATG 2 cut(s) 80, 479
FspBI CTAG 1 cut(s) 258
GlaI GCGC 1 cut(s) 140
GsaI CCCAGC 2 cut(s) 43, 423
HaeIII GGCC 1 cut(s) 24
HhaI GCGC 1 cut(s) 141
Hin6I GCGC 1 cut(s) 139
HinP1I GCGC 1 cut(s) 139
HindIII AAGCTT 1 cut(s) 167
HinfI GANTC 1 cut(s) 380
Hpy188I TCNGA 8 cut(s) 76, 159, 195, 209, 334, 361, 444, 493
Hpy188III TCNNGA 1 cut(s) 32
HpyAV CCTTC 2 cut(s) 226, 309
HpyCH4III ACNGT 2 cut(s) 199, 449
HpyF10VI GCNNNNNNNGC 1 cut(s) 416
HpyF3I CTNAG 6 cut(s) 48, 156, 206, 337, 366, 490
HspAI GCGC 1 cut(s) 139
Kzo9I GATC 1 cut(s) 71
LmnI GCTCC 1 cut(s) 335
LweI GCATC 1 cut(s) 126
MaeI CTAG 1 cut(s) 258
MaeIII GTNAC 3 cut(s) 250, 266, 310
MalI GATC 1 cut(s) 73
MboI GATC 1 cut(s) 71
MboII GAAGA 2 cut(s) 409, 482
MluCI AATT 3 cut(s) 27, 220, 438
MmeI TCCRAC 1 cut(s) 357
MnlI CCTC 4 cut(s) 37, 316, 334, 361
MseI TTAA 2 cut(s) 201, 511
MwoI GCNNNNNNNGC 1 cut(s) 416
NdeI CATATG 2 cut(s) 124, 151
NdeII GATC 1 cut(s) 71
NlaIV GGNNCC 1 cut(s) 227
PfeI GAWTC 1 cut(s) 380
PspFI CCCAGC 2 cut(s) 39, 419
PspN4I GGNNCC 1 cut(s) 227
PspPI GGNCC 2 cut(s) 23, 225
PsrI GAACNNNNNNTAC 2 cut(s) 235, 267
SaqAI TTAA 2 cut(s) 201, 511
Sau3AI GATC 1 cut(s) 71
Sau96I GGNCC 2 cut(s) 23, 225
SetI ASST 6 cut(s) 171, 207, 220, 332, 412, 456
SfaNI GCATC 1 cut(s) 126
SfcI CTRYAG 1 cut(s) 246
SinI GGWCC 1 cut(s) 225
Sse9I AATT 3 cut(s) 27, 220, 438
SspMI CTAG 1 cut(s) 258
StyI CCWWGG 1 cut(s) 257
TaaI ACNGT 2 cut(s) 199, 449
TaqI TCGA 1 cut(s) 307
TasI AATT 3 cut(s) 27, 220, 438
TfiI GAWTC 1 cut(s) 380
Tru1I TTAA 2 cut(s) 201, 511
Tru9I TTAA 2 cut(s) 201, 511
TscAI CASTG 4 cut(s) 89, 300, 382, 454
TspDTI ATGAA 1 cut(s) 483
TspRI CASTG 4 cut(s) 89, 300, 382, 454
VpaK11BI GGWCC 1 cut(s) 225
XapI RAATTY 1 cut(s) 438
XmaJI CCTAGG 1 cut(s) 257
XspI CTAG 1 cut(s) 258
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.