Rw2G034740

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr2
Physical Location & Seq
Forward (+)
57208504 .. 57211127
2624 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw2G034740.1

Sequence Viewer

Length: 222 bp
ATGGTGGATAAGAACTTGCCAGGCCCAATTCCTGATGGCTGGGAGATTAAGACTGAATACCAGAAGGATGGATCTGAAATCCCGTGTTACTGGTGTCCCAGAAGTGGTCTCCATTCCATCACATATGAAGATATGATGCGATATCCAAACAACTCCAATACTACATCTAATTTTTTGTTCTTGGAACAGGAACCAGATCCTCCAGAACAGGCCAAAAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

73

Amino Acids

8.48

Weight (kDa)

4.61

Isoelectric Point (pI)

35.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 79, 191
AfiI CCNNNNNNNGG 1 cut(s) 104
AjnI CCWGG 1 cut(s) 19
Alw26I GTCTC 1 cut(s) 113
AlwI GGATC 2 cut(s) 79, 191
AoxI GGCC 2 cut(s) 22, 210
AspS9I GGNCC 1 cut(s) 23
BccI CCATC 3 cut(s) 29, 62, 125
BciT130I CCWGG 1 cut(s) 21
BcoDI GTCTC 1 cut(s) 113
Bme1390I CCNGG 1 cut(s) 21
BmgT120I GGNCC 1 cut(s) 23
BmiI GGNNCC 1 cut(s) 192
BmrFI CCNGG 1 cut(s) 21
BmsI GCATC 1 cut(s) 126
BpmI CTGGAG 1 cut(s) 186
BsaI GGTCTC 1 cut(s) 113
Bsc4I CCNNNNNNNGG 1 cut(s) 104
Bse1I ACTGG 1 cut(s) 95
BseBI CCWGG 1 cut(s) 21
BseGI GGATG 1 cut(s) 73
BseLI CCNNNNNNNGG 1 cut(s) 104
BseNI ACTGG 1 cut(s) 95
BseYI CCCAGC 1 cut(s) 39
BshFI GGCC 2 cut(s) 24, 212
BslFI GGGAC 1 cut(s) 81
BslI CCNNNNNNNGG 1 cut(s) 104
BsmAI GTCTC 1 cut(s) 113
BsmFI GGGAC 1 cut(s) 81
BsnI GGCC 2 cut(s) 24, 212
Bso31I GGTCTC 1 cut(s) 113
Bsp143I GATC 2 cut(s) 71, 196
BspANI GGCC 2 cut(s) 24, 212
BspLI GGNNCC 1 cut(s) 192
BspPI GGATC 2 cut(s) 79, 191
BspTNI GGTCTC 1 cut(s) 113
BsrI ACTGG 1 cut(s) 95
BssMI GATC 2 cut(s) 71, 196
Bst2UI CCWGG 1 cut(s) 21
BstF5I GGATG 1 cut(s) 73
BstKTI GATC 2 cut(s) 74, 199
BstMAI GTCTC 1 cut(s) 113
BstMBI GATC 2 cut(s) 71, 196
BstNI CCWGG 1 cut(s) 21
BstSCI CCNGG 1 cut(s) 19
BstX2I RGATCY 2 cut(s) 71, 196
BstXI CCANNNNNNTGG 1 cut(s) 68
BstYI RGATCY 2 cut(s) 71, 196
BsuRI GGCC 2 cut(s) 24, 212
BtsCI GGATG 1 cut(s) 73
Cfr13I GGNCC 1 cut(s) 23
CviJI RGCY 3 cut(s) 24, 39, 212
CviKI_1 RGCY 3 cut(s) 24, 39, 212
DpnI GATC 2 cut(s) 73, 198
DpnII GATC 2 cut(s) 71, 196
Eco31I GGTCTC 1 cut(s) 113
Eco32I GATATC 1 cut(s) 143
EcoRII CCWGG 1 cut(s) 19
EcoRV GATATC 1 cut(s) 143
FaiI YATR 3 cut(s) 124, 126, 134
FaqI GGGAC 1 cut(s) 81
FauNDI CATATG 1 cut(s) 124
FokI GGATG 1 cut(s) 80
GsaI CCCAGC 1 cut(s) 43
GsuI CTGGAG 1 cut(s) 186
HaeIII GGCC 2 cut(s) 24, 212
Hpy188I TCNGA 1 cut(s) 76
Hpy188III TCNNGA 2 cut(s) 32, 203
HpyAV CCTTC 1 cut(s) 58
Kzo9I GATC 2 cut(s) 71, 196
LweI GCATC 1 cut(s) 126
MaeIII GTNAC 1 cut(s) 86
MalI GATC 2 cut(s) 73, 198
MboI GATC 2 cut(s) 71, 196
MboII GAAGA 1 cut(s) 140
MflI RGATCY 2 cut(s) 71, 196
MluCI AATT 2 cut(s) 27, 169
MnlI CCTC 1 cut(s) 210
MseI TTAA 1 cut(s) 48
MspR9I CCNGG 1 cut(s) 21
MvaI CCWGG 1 cut(s) 21
NdeI CATATG 1 cut(s) 124
NdeII GATC 2 cut(s) 71, 196
NlaIV GGNNCC 1 cut(s) 192
Psp6I CCWGG 1 cut(s) 19
PspFI CCCAGC 1 cut(s) 39
PspGI CCWGG 1 cut(s) 19
PspN4I GGNNCC 1 cut(s) 192
PspPI GGNCC 1 cut(s) 23
PsuI RGATCY 2 cut(s) 71, 196
SaqAI TTAA 1 cut(s) 48
Sau3AI GATC 2 cut(s) 71, 196
Sau96I GGNCC 1 cut(s) 23
ScrFI CCNGG 1 cut(s) 21
SfaNI GCATC 1 cut(s) 126
Sse9I AATT 2 cut(s) 27, 169
StyD4I CCNGG 1 cut(s) 19
TasI AATT 2 cut(s) 27, 169
Tru1I TTAA 1 cut(s) 48
Tru9I TTAA 1 cut(s) 48
TspDTI ATGAA 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.