Rh2DG443500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Forward (+)
64402499 .. 64402651
153 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG443500.1

Sequence Viewer

Length: 153 bp
ATGGTGGATAAGAACTTGCCAGGCCCAATTCCTGATGGCTGGGAGATTAAGACTGAATACCAGAAGGATGGATCTGAAATCCCGTGTTACTGGTGTCCCAGAAGTGGTCTCCATTCCATCACATATGAAGATATGATGCGATATGTAAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

50

Amino Acids

5.88

Weight (kDa)

5.08

Isoelectric Point (pI)

28.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 79
AfiI CCNNNNNNNGG 1 cut(s) 104
AjnI CCWGG 1 cut(s) 19
Alw26I GTCTC 1 cut(s) 113
AlwI GGATC 1 cut(s) 79
AoxI GGCC 1 cut(s) 22
AspS9I GGNCC 1 cut(s) 23
BccI CCATC 3 cut(s) 29, 62, 125
BciT130I CCWGG 1 cut(s) 21
BcoDI GTCTC 1 cut(s) 113
Bme1390I CCNGG 1 cut(s) 21
BmgT120I GGNCC 1 cut(s) 23
BmrFI CCNGG 1 cut(s) 21
BmsI GCATC 1 cut(s) 126
BsaI GGTCTC 1 cut(s) 113
Bsc4I CCNNNNNNNGG 1 cut(s) 104
Bse1I ACTGG 1 cut(s) 95
BseBI CCWGG 1 cut(s) 21
BseGI GGATG 1 cut(s) 73
BseLI CCNNNNNNNGG 1 cut(s) 104
BseNI ACTGG 1 cut(s) 95
BseYI CCCAGC 1 cut(s) 39
BshFI GGCC 1 cut(s) 24
BslFI GGGAC 1 cut(s) 81
BslI CCNNNNNNNGG 1 cut(s) 104
BsmAI GTCTC 1 cut(s) 113
BsmFI GGGAC 1 cut(s) 81
BsnI GGCC 1 cut(s) 24
Bso31I GGTCTC 1 cut(s) 113
Bsp143I GATC 1 cut(s) 71
BspANI GGCC 1 cut(s) 24
BspPI GGATC 1 cut(s) 79
BspTNI GGTCTC 1 cut(s) 113
BsrI ACTGG 1 cut(s) 95
BssMI GATC 1 cut(s) 71
Bst2UI CCWGG 1 cut(s) 21
BstF5I GGATG 1 cut(s) 73
BstKTI GATC 1 cut(s) 74
BstMAI GTCTC 1 cut(s) 113
BstMBI GATC 1 cut(s) 71
BstNI CCWGG 1 cut(s) 21
BstSCI CCNGG 1 cut(s) 19
BstX2I RGATCY 1 cut(s) 71
BstXI CCANNNNNNTGG 1 cut(s) 68
BstYI RGATCY 1 cut(s) 71
BsuRI GGCC 1 cut(s) 24
BtsCI GGATG 1 cut(s) 73
Cfr13I GGNCC 1 cut(s) 23
CviJI RGCY 2 cut(s) 24, 39
CviKI_1 RGCY 2 cut(s) 24, 39
DpnI GATC 1 cut(s) 73
DpnII GATC 1 cut(s) 71
Eco31I GGTCTC 1 cut(s) 113
EcoRII CCWGG 1 cut(s) 19
FaiI YATR 4 cut(s) 124, 126, 134, 144
FaqI GGGAC 1 cut(s) 81
FauNDI CATATG 1 cut(s) 124
FokI GGATG 1 cut(s) 80
GsaI CCCAGC 1 cut(s) 43
HaeIII GGCC 1 cut(s) 24
Hpy188I TCNGA 1 cut(s) 76
Hpy188III TCNNGA 1 cut(s) 32
HpyAV CCTTC 1 cut(s) 58
Kzo9I GATC 1 cut(s) 71
LpnPI CCDG 7 cut(s) 6, 25, 33, 45, 74, 76, 112
LweI GCATC 1 cut(s) 126
MaeIII GTNAC 1 cut(s) 86
MalI GATC 1 cut(s) 73
MboI GATC 1 cut(s) 71
MboII GAAGA 1 cut(s) 140
MflI RGATCY 1 cut(s) 71
MluCI AATT 1 cut(s) 27
MseI TTAA 1 cut(s) 48
MspR9I CCNGG 1 cut(s) 21
MvaI CCWGG 1 cut(s) 21
NdeI CATATG 1 cut(s) 124
NdeII GATC 1 cut(s) 71
Psp6I CCWGG 1 cut(s) 19
PspFI CCCAGC 1 cut(s) 39
PspGI CCWGG 1 cut(s) 19
PspPI GGNCC 1 cut(s) 23
PsuI RGATCY 1 cut(s) 71
SaqAI TTAA 1 cut(s) 48
Sau3AI GATC 1 cut(s) 71
Sau96I GGNCC 1 cut(s) 23
ScrFI CCNGG 1 cut(s) 21
SfaNI GCATC 1 cut(s) 126
Sse9I AATT 1 cut(s) 27
StyD4I CCNGG 1 cut(s) 19
TasI AATT 1 cut(s) 27
Tru1I TTAA 1 cut(s) 48
Tru9I TTAA 1 cut(s) 48
TspDTI ATGAA 1 cut(s) 141
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.