pycom10g14150

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
Physical Location & Seq
Reverse (-)
17547144 .. 17550280
3137 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom10g14150.1

Sequence Viewer

Length: 372 bp
ATGGCACCGAGGAATAGGTGGCTTCAGATTCCTGAAGGTTGGGAGTTGGATAAAAGAGAAGGGAATCATGTAAAGGGCTTCTTCTGTCCCAGAACAGGCCAATCATTTCTGACGTATGAACATCTTATGCGCTATATGAGATGGGTCAACTATTATGCAGATTCCAATGCCAACAAGCCGAACAATGGAGCAATCTTTAAATTTGGGGAAAATCCTTCATCGGGCCAGAACCCAAAACCATTGATGATTGAACAAGGGTACACTGGAGCCTCGACTCAAAAGCCAGATCCAAATTTTCAGTTTGTTGCCAAGCCGAGCACTTCAAAGGCCAAGCACAAACAGCAAAGGCGAAAGCGAAGGACACCGATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

124

Amino Acids

14.33

Weight (kDa)

10.21

Isoelectric Point (pI)

52.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 4
AclWI GGATC 1 cut(s) 281
AcsI RAATTY 2 cut(s) 200, 292
AcuI CTGAAG 2 cut(s) 8, 54
AfaI GTAC 1 cut(s) 260
AfiI CCNNNNNNNGG 3 cut(s) 95, 185, 221
AgsI TTSAA 2 cut(s) 251, 324
Alw21I GWGCWC 1 cut(s) 320
AlwI GGATC 1 cut(s) 281
AoxI GGCC 3 cut(s) 97, 223, 327
ApoI RAATTY 2 cut(s) 200, 292
AspLEI GCGC 1 cut(s) 132
AspS9I GGNCC 1 cut(s) 223
BanI GGYRCC 1 cut(s) 4
Bbv12I GWGCWC 1 cut(s) 320
BccI CCATC 1 cut(s) 135
BmgT120I GGNCC 1 cut(s) 223
BmiI GGNNCC 2 cut(s) 6, 268
BpmI CTGGAG 1 cut(s) 285
BsaJI CCNNGG 1 cut(s) 8
Bsc4I CCNNNNNNNGG 3 cut(s) 95, 185, 221
Bse1I ACTGG 1 cut(s) 268
BseDI CCNNGG 1 cut(s) 8
BseLI CCNNNNNNNGG 3 cut(s) 95, 185, 221
BseNI ACTGG 1 cut(s) 268
BshFI GGCC 3 cut(s) 99, 225, 329
BshNI GGYRCC 1 cut(s) 4
BsiHKAI GWGCWC 1 cut(s) 320
BslFI GGGAC 1 cut(s) 72
BslI CCNNNNNNNGG 3 cut(s) 95, 185, 221
BsmFI GGGAC 1 cut(s) 72
BsnI GGCC 3 cut(s) 99, 225, 329
Bsp1286I GDGCHC 1 cut(s) 320
Bsp143I GATC 1 cut(s) 286
BspANI GGCC 3 cut(s) 99, 225, 329
BspLI GGNNCC 2 cut(s) 6, 268
BspPI GGATC 1 cut(s) 281
BspT107I GGYRCC 1 cut(s) 4
BsrI ACTGG 1 cut(s) 268
BssECI CCNNGG 1 cut(s) 8
BssMI GATC 1 cut(s) 286
BstHHI GCGC 1 cut(s) 132
BstKTI GATC 1 cut(s) 289
BstMBI GATC 1 cut(s) 286
BstMWI GCNNNNNNNGC 1 cut(s) 340
BstX2I RGATCY 1 cut(s) 286
BstYI RGATCY 1 cut(s) 286
BsuRI GGCC 3 cut(s) 99, 225, 329
BtsIMutI CAGTG 1 cut(s) 261
CfoI GCGC 1 cut(s) 132
Cfr13I GGNCC 1 cut(s) 223
Csp6I GTAC 1 cut(s) 259
CviAII CATG 1 cut(s) 68
CviJI RGCY 9 cut(s) 22, 78, 99, 178, 225, 269, 283, 313, 329
CviKI_1 RGCY 9 cut(s) 22, 78, 99, 178, 225, 269, 283, 313, 329
CviQI GTAC 1 cut(s) 259
DpnI GATC 1 cut(s) 288
DpnII GATC 1 cut(s) 286
DraI TTTAAA 1 cut(s) 199
Eco57I CTGAAG 2 cut(s) 8, 54
FaeI CATG 1 cut(s) 71
FaiI YATR 7 cut(s) 69, 117, 128, 135, 137, 156, 370
FalI AAGNNNNNCTT 2 cut(s) 65, 97
FaqI GGGAC 1 cut(s) 72
FatI CATG 1 cut(s) 67
GlaI GCGC 1 cut(s) 131
GsuI CTGGAG 1 cut(s) 285
HaeIII GGCC 3 cut(s) 99, 225, 329
HhaI GCGC 1 cut(s) 132
Hin1II CATG 1 cut(s) 71
Hin6I GCGC 1 cut(s) 130
HinP1I GCGC 1 cut(s) 130
HincII GTYRAC 1 cut(s) 148
HindII GTYRAC 1 cut(s) 148
HinfI GANTC 4 cut(s) 28, 64, 161, 274
Hpy166II GTNNAC 2 cut(s) 148, 261
Hpy188I TCNGA 2 cut(s) 27, 111
Hpy188III TCNNGA 1 cut(s) 32
Hpy8I GTNNAC 2 cut(s) 148, 261
HpyAV CCTTC 4 cut(s) 29, 53, 225, 351
HpyCH4IV ACGT 1 cut(s) 113
HpyCH4V TGCA 1 cut(s) 158
HpyF10VI GCNNNNNNNGC 1 cut(s) 340
HpySE526I ACGT 1 cut(s) 113
Hsp92II CATG 1 cut(s) 71
HspAI GCGC 1 cut(s) 130
Kzo9I GATC 1 cut(s) 286
LmnI GCTCC 2 cut(s) 188, 266
LpnPI CCDG 6 cut(s) 45, 81, 103, 239, 249, 297
MaeII ACGT 1 cut(s) 113
MalI GATC 1 cut(s) 288
MboI GATC 1 cut(s) 286
MboII GAAGA 1 cut(s) 73
MflI RGATCY 1 cut(s) 286
MhlI GDGCHC 1 cut(s) 320
MluCI AATT 2 cut(s) 200, 292
MlyI GAGTC 1 cut(s) 268
MmeI TCCRAC 1 cut(s) 27
MnlI CCTC 2 cut(s) 3, 280
MseI TTAA 1 cut(s) 198
MwoI GCNNNNNNNGC 1 cut(s) 340
NdeII GATC 1 cut(s) 286
NlaIII CATG 1 cut(s) 71
NlaIV GGNNCC 2 cut(s) 6, 268
NmeAIII GCCGAG 1 cut(s) 339
PfeI GAWTC 3 cut(s) 28, 64, 161
PleI GAGTC 1 cut(s) 268
PpsI GAGTC 1 cut(s) 268
PspN4I GGNNCC 2 cut(s) 6, 268
PspPI GGNCC 1 cut(s) 223
PsuI RGATCY 1 cut(s) 286
RsaI GTAC 1 cut(s) 260
RsaNI GTAC 1 cut(s) 259
SaqAI TTAA 1 cut(s) 198
Sau3AI GATC 1 cut(s) 286
Sau96I GGNCC 1 cut(s) 223
SchI GAGTC 1 cut(s) 268
SduI GDGCHC 1 cut(s) 320
SetI ASST 3 cut(s) 20, 40, 116
Sse9I AATT 2 cut(s) 200, 292
TaiI ACGT 1 cut(s) 116
TaqI TCGA 1 cut(s) 272
TasI AATT 2 cut(s) 200, 292
TfiI GAWTC 3 cut(s) 28, 64, 161
Tru1I TTAA 1 cut(s) 198
Tru9I TTAA 1 cut(s) 198
TscAI CASTG 1 cut(s) 268
TspDTI ATGAA 2 cut(s) 132, 207
TspRI CASTG 1 cut(s) 268
XapI RAATTY 2 cut(s) 200, 292
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.