Rroxscaffold_2G00103230

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
25748237 .. 25749299
1063 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00103230.1

Sequence Viewer

Length: 159 bp
ATGGGAACACTTGAACTTGGAGGCATCTTTGCTCCTTCAAGAATCCACCCTCATTCGCCAGGACCAATTCCTGATGGCCGGGAGATTAAGACTGAACACCAGAAGGATGGATCTGAAATCCGGTGCTACTGCTGTCCTAGAAGTGGTATGAAGATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

52

Amino Acids

5.7

Weight (kDa)

7.78

Isoelectric Point (pI)

49.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 118
AcoI YGGCCR 1 cut(s) 76
AfiI CCNNNNNNNGG 1 cut(s) 143
AgsI TTSAA 2 cut(s) 14, 39
AjnI CCWGG 1 cut(s) 58
AlwI GGATC 1 cut(s) 118
AoxI GGCC 1 cut(s) 76
AspS9I GGNCC 1 cut(s) 62
AsuC2I CCSGG 1 cut(s) 80
AvaII GGWCC 1 cut(s) 62
BccI CCATC 2 cut(s) 68, 101
BciT130I CCWGG 1 cut(s) 60
BcnI CCSGG 1 cut(s) 80
BfaI CTAG 1 cut(s) 138
Bme1390I CCNGG 2 cut(s) 60, 80
Bme18I GGWCC 1 cut(s) 62
BmgT120I GGNCC 1 cut(s) 62
BmrFI CCNGG 2 cut(s) 60, 80
BmsI GCATC 1 cut(s) 33
BpuMI CCSGG 1 cut(s) 80
BsaWI WCCGGW 1 cut(s) 120
Bsc4I CCNNNNNNNGG 1 cut(s) 143
BseBI CCWGG 1 cut(s) 60
BseGI GGATG 1 cut(s) 112
BseLI CCNNNNNNNGG 1 cut(s) 143
BshFI GGCC 1 cut(s) 78
BsiSI CCGG 2 cut(s) 79, 121
BslI CCNNNNNNNGG 1 cut(s) 143
BsnI GGCC 1 cut(s) 78
Bsp143I GATC 1 cut(s) 110
BspANI GGCC 1 cut(s) 78
BspPI GGATC 1 cut(s) 118
BssMI GATC 1 cut(s) 110
Bst2UI CCWGG 1 cut(s) 60
BstF5I GGATG 1 cut(s) 112
BstKTI GATC 1 cut(s) 113
BstMBI GATC 1 cut(s) 110
BstNI CCWGG 1 cut(s) 60
BstSCI CCNGG 2 cut(s) 58, 78
BstX2I RGATCY 1 cut(s) 110
BstXI CCANNNNNNTGG 1 cut(s) 107
BstYI RGATCY 1 cut(s) 110
BsuRI GGCC 1 cut(s) 78
BtsCI GGATG 1 cut(s) 112
Cfr13I GGNCC 1 cut(s) 62
CviJI RGCY 1 cut(s) 78
CviKI_1 RGCY 1 cut(s) 78
DpnI GATC 1 cut(s) 112
DpnII GATC 1 cut(s) 110
EaeI YGGCCR 1 cut(s) 76
Eco47I GGWCC 1 cut(s) 62
EcoRII CCWGG 1 cut(s) 58
FaiI YATR 2 cut(s) 149, 157
FokI GGATG 1 cut(s) 119
FspBI CTAG 1 cut(s) 138
HaeIII GGCC 1 cut(s) 78
HapII CCGG 2 cut(s) 79, 121
HinfI GANTC 1 cut(s) 42
HpaII CCGG 2 cut(s) 79, 121
Hpy188I TCNGA 1 cut(s) 115
Hpy188III TCNNGA 2 cut(s) 39, 71
HpyAV CCTTC 2 cut(s) 45, 97
Kzo9I GATC 1 cut(s) 110
LmnI GCTCC 1 cut(s) 37
LpnPI CCDG 6 cut(s) 45, 72, 84, 92, 113, 134
LweI GCATC 1 cut(s) 33
MaeI CTAG 1 cut(s) 138
MalI GATC 1 cut(s) 112
MboI GATC 1 cut(s) 110
MflI RGATCY 1 cut(s) 110
MluCI AATT 1 cut(s) 66
MnlI CCTC 2 cut(s) 14, 60
MseI TTAA 1 cut(s) 87
MspI CCGG 2 cut(s) 79, 121
MspR9I CCNGG 2 cut(s) 60, 80
MvaI CCWGG 1 cut(s) 60
NciI CCSGG 1 cut(s) 80
NdeII GATC 1 cut(s) 110
PfeI GAWTC 1 cut(s) 42
Psp6I CCWGG 1 cut(s) 58
PspGI CCWGG 1 cut(s) 58
PspPI GGNCC 1 cut(s) 62
PsuI RGATCY 1 cut(s) 110
SaqAI TTAA 1 cut(s) 87
Sau3AI GATC 1 cut(s) 110
Sau96I GGNCC 1 cut(s) 62
ScrFI CCNGG 2 cut(s) 60, 80
SfaNI GCATC 1 cut(s) 33
SinI GGWCC 1 cut(s) 62
Sse9I AATT 1 cut(s) 66
SspMI CTAG 1 cut(s) 138
StyD4I CCNGG 2 cut(s) 58, 78
TasI AATT 1 cut(s) 66
TfiI GAWTC 1 cut(s) 42
Tru1I TTAA 1 cut(s) 87
Tru9I TTAA 1 cut(s) 87
VpaK11BI GGWCC 1 cut(s) 62
XspI CTAG 1 cut(s) 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.