Rh1DG242800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Reverse (-)
45847123 .. 45849669
2547 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG242800.1

Sequence Viewer

Length: 309 bp
ATGGAGGATAAGAACTCGTCAGGCCCAATTCCTGATGGCTGGGAGGTTAAGACTGAACGCCAGAAGGACGGATCTGAAATCCCGTTTGTTAAAAACAACACTCACCCGAGACTAAAACTAACTTTTCCAGAGGAAAGCTCCGACTTAGAGGAAAGGACTACCCTGTCTAACCCTGAGGTCAGTACTGAATCTACTAATACAGGGAAGGATATGGAAGCTAGTCAGGCTGGGATTGACAAGGAACCAGAAATTTTGAGCAGTGACCTTGAAGCATTGTTAATTGGGATTGAGAAATTAAGCCTTTGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

102

Amino Acids

11.26

Weight (kDa)

4.42

Isoelectric Point (pI)

46.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 163
AclWI GGATC 1 cut(s) 79
AcsI RAATTY 1 cut(s) 249
AfaI GTAC 1 cut(s) 184
AgsI TTSAA 1 cut(s) 269
AluBI AGCT 2 cut(s) 138, 218
AluI AGCT 2 cut(s) 138, 218
Alw26I GTCTC 1 cut(s) 103
AlwI GGATC 1 cut(s) 79
Ama87I CYCGRG 1 cut(s) 106
AoxI GGCC 1 cut(s) 22
ApoI RAATTY 1 cut(s) 249
AspS9I GGNCC 1 cut(s) 23
AsuHPI GGTGA 1 cut(s) 95
AvaI CYCGRG 1 cut(s) 106
AxyI CCTNAGG 1 cut(s) 174
BccI CCATC 1 cut(s) 29
BcoDI GTCTC 1 cut(s) 103
BfaI CTAG 1 cut(s) 219
BmcAI AGTACT 1 cut(s) 184
BmeT110I CYCGRG 1 cut(s) 106
BmgT120I GGNCC 1 cut(s) 23
BmiI GGNNCC 1 cut(s) 243
BplI GAGNNNNNCTC 2 cut(s) 122, 154
Bse21I CCTNAGG 1 cut(s) 174
BseMII CTCAG 1 cut(s) 165
BseYI CCCAGC 2 cut(s) 39, 227
BshFI GGCC 1 cut(s) 24
BsiHKCI CYCGRG 1 cut(s) 106
BsmAI GTCTC 1 cut(s) 103
BsnI GGCC 1 cut(s) 24
BsoBI CYCGRG 1 cut(s) 106
Bsp143I GATC 1 cut(s) 71
BspANI GGCC 1 cut(s) 24
BspCNI CTCAG 1 cut(s) 166
BspLI GGNNCC 1 cut(s) 243
BspPI GGATC 1 cut(s) 79
BssMI GATC 1 cut(s) 71
BstDEI CTNAG 2 cut(s) 145, 174
BstKTI GATC 1 cut(s) 74
BstMAI GTCTC 1 cut(s) 103
BstMBI GATC 1 cut(s) 71
BstMWI GCNNNNNNNGC 1 cut(s) 224
BstX2I RGATCY 1 cut(s) 71
BstYI RGATCY 1 cut(s) 71
Bsu36I CCTNAGG 1 cut(s) 174
BsuRI GGCC 1 cut(s) 24
BtsI GCAGTG 1 cut(s) 265
BtsIMutI CAGTG 1 cut(s) 265
Cfr13I GGNCC 1 cut(s) 23
Csp6I GTAC 1 cut(s) 183
CviJI RGCY 6 cut(s) 24, 39, 138, 218, 227, 300
CviKI_1 RGCY 6 cut(s) 24, 39, 138, 218, 227, 300
CviQI GTAC 1 cut(s) 183
DdeI CTNAG 2 cut(s) 145, 174
DpnI GATC 1 cut(s) 73
DpnII GATC 1 cut(s) 71
DrdI GACNNNNNNGTC 1 cut(s) 163
DseDI GACNNNNNNGTC 1 cut(s) 163
Eco81I CCTNAGG 1 cut(s) 174
Eco88I CYCGRG 1 cut(s) 106
FaiI YATR 1 cut(s) 212
FspBI CTAG 1 cut(s) 219
GsaI CCCAGC 2 cut(s) 43, 231
HaeIII GGCC 1 cut(s) 24
HinfI GANTC 1 cut(s) 188
HphI GGTGA 1 cut(s) 95
Hpy188I TCNGA 2 cut(s) 76, 142
Hpy188III TCNNGA 2 cut(s) 32, 128
HpyAV CCTTC 2 cut(s) 58, 199
HpyF10VI GCNNNNNNNGC 1 cut(s) 224
HpyF3I CTNAG 2 cut(s) 145, 174
Kzo9I GATC 1 cut(s) 71
LmnI GCTCC 1 cut(s) 143
MaeI CTAG 1 cut(s) 219
MaeIII GTNAC 1 cut(s) 260
MalI GATC 1 cut(s) 73
MboI GATC 1 cut(s) 71
MflI RGATCY 1 cut(s) 71
MluCI AATT 4 cut(s) 27, 249, 279, 293
MmeI TCCRAC 1 cut(s) 165
MnlI CCTC 4 cut(s) 37, 124, 142, 169
MseI TTAA 4 cut(s) 48, 90, 278, 296
MwoI GCNNNNNNNGC 1 cut(s) 224
NdeII GATC 1 cut(s) 71
NlaIV GGNNCC 1 cut(s) 243
NmuCI GTSAC 1 cut(s) 260
PfeI GAWTC 1 cut(s) 188
PspFI CCCAGC 2 cut(s) 39, 227
PspN4I GGNNCC 1 cut(s) 243
PspPI GGNCC 1 cut(s) 23
PsuI RGATCY 1 cut(s) 71
RsaI GTAC 1 cut(s) 184
RsaNI GTAC 1 cut(s) 183
SaqAI TTAA 4 cut(s) 48, 90, 278, 296
Sau3AI GATC 1 cut(s) 71
Sau96I GGNCC 1 cut(s) 23
ScaI AGTACT 1 cut(s) 184
SetI ASST 5 cut(s) 48, 140, 180, 220, 267
Sse9I AATT 4 cut(s) 27, 249, 279, 293
SspMI CTAG 1 cut(s) 219
TasI AATT 4 cut(s) 27, 249, 279, 293
TatI WGTACW 1 cut(s) 182
TfiI GAWTC 1 cut(s) 188
Tru1I TTAA 4 cut(s) 48, 90, 278, 296
Tru9I TTAA 4 cut(s) 48, 90, 278, 296
TscAI CASTG 1 cut(s) 265
TseFI GTSAC 1 cut(s) 260
Tsp45I GTSAC 1 cut(s) 260
TspGWI ACGGA 1 cut(s) 84
TspRI CASTG 1 cut(s) 265
XapI RAATTY 1 cut(s) 249
XspI CTAG 1 cut(s) 219
ZrmI AGTACT 1 cut(s) 184
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.