RchiOBHm_Chr1g0353031

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
OG0004867
Physical Location & Seq
Reverse (-)
46362295 .. 46366113
3819 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ57868

Sequence Viewer

Length: 501 bp
ATGGAGGATAAGAACTCGTCAGGCCCAATTCCTGATGGCTGGGAGGTTAAGACTGAATGCCAGAAGGATGGATCTGAAATCCCGTTCTACTGGTGTCCCAGAAGTGGTCAGCATTTCTACACATATAAAGATATGATGCGATATGTAGAATATGCTCAGAAAAACCAGCTTTCGATCTACTCACCAGATTTTCAGACCATGAAAATTAGAAAGAAAGCTAATTGGTCCCACAAGGGGAACAGAACTATAATTGCTCCTCGGAGAAGTCACTTTCTGGGGGAGAGTTCAAAGACACTGCCTTCTTATCGGGTAACTTTTCTAGAGGAAAGCTCCGACTTAGAGGAAAGGACTACCCTGTCTAACCCTGAGGTCAGTACTGAATCTACTAATACAGGGAAGGATATGGAAGCTAGTCAGGCTGGGATTGACAAGGAACCAGAAATTTTGAGCAGTGACCTTGAAGCATTGTTAATTGGGATTGAGAAATTAAGCCTTTGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
MBD

Protein Analysis

166

Amino Acids

18.99

Weight (kDa)

5.31

Isoelectric Point (pI)

48.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 355
AclWI GGATC 1 cut(s) 79
AcsI RAATTY 1 cut(s) 441
AfaI GTAC 1 cut(s) 376
AfiI CCNNNNNNNGG 2 cut(s) 104, 234
AgsI TTSAA 2 cut(s) 288, 461
AluBI AGCT 4 cut(s) 169, 218, 330, 410
AluI AGCT 4 cut(s) 169, 218, 330, 410
AlwI GGATC 1 cut(s) 79
AoxI GGCC 1 cut(s) 22
ApoI RAATTY 1 cut(s) 441
AspS9I GGNCC 2 cut(s) 23, 225
AsuHPI GGTGA 1 cut(s) 174
AvaII GGWCC 1 cut(s) 225
AxyI CCTNAGG 1 cut(s) 366
BccI CCATC 2 cut(s) 29, 62
BfaI CTAG 2 cut(s) 320, 411
BmcAI AGTACT 1 cut(s) 376
Bme18I GGWCC 1 cut(s) 225
BmgT120I GGNCC 2 cut(s) 23, 225
BmiI GGNNCC 2 cut(s) 227, 435
BmsI GCATC 1 cut(s) 126
BplI GAGNNNNNCTC 2 cut(s) 314, 346
BsaJI CCNNGG 1 cut(s) 257
Bsc4I CCNNNNNNNGG 2 cut(s) 104, 234
Bse1I ACTGG 1 cut(s) 95
Bse21I CCTNAGG 1 cut(s) 366
BseDI CCNNGG 1 cut(s) 257
BseGI GGATG 1 cut(s) 73
BseLI CCNNNNNNNGG 2 cut(s) 104, 234
BseMII CTCAG 2 cut(s) 170, 357
BseNI ACTGG 1 cut(s) 95
BseRI GAGGAG 1 cut(s) 246
BseYI CCCAGC 2 cut(s) 39, 419
BshFI GGCC 1 cut(s) 24
BslFI GGGAC 2 cut(s) 81, 211
BslI CCNNNNNNNGG 2 cut(s) 104, 234
BsmFI GGGAC 2 cut(s) 81, 211
BsmI GAATGC 1 cut(s) 62
BsnI GGCC 1 cut(s) 24
Bsp143I GATC 2 cut(s) 71, 174
BspANI GGCC 1 cut(s) 24
BspCNI CTCAG 2 cut(s) 169, 358
BspLI GGNNCC 2 cut(s) 227, 435
BspPI GGATC 1 cut(s) 79
BsrI ACTGG 1 cut(s) 95
BssECI CCNNGG 1 cut(s) 257
BssMI GATC 2 cut(s) 71, 174
BstDEI CTNAG 3 cut(s) 156, 337, 366
BstF5I GGATG 1 cut(s) 73
BstKTI GATC 2 cut(s) 74, 177
BstMBI GATC 2 cut(s) 71, 174
BstMWI GCNNNNNNNGC 1 cut(s) 416
BstX2I RGATCY 1 cut(s) 71
BstXI CCANNNNNNTGG 1 cut(s) 68
BstYI RGATCY 1 cut(s) 71
Bsu36I CCTNAGG 1 cut(s) 366
BsuRI GGCC 1 cut(s) 24
BtsCI GGATG 1 cut(s) 73
BtsI GCAGTG 2 cut(s) 293, 457
BtsIMutI CAGTG 2 cut(s) 293, 457
Cfr13I GGNCC 2 cut(s) 23, 225
Csp6I GTAC 1 cut(s) 375
CviAII CATG 1 cut(s) 199
CviJI RGCY 8 cut(s) 24, 39, 169, 218, 330, 410, 419, 492
CviKI_1 RGCY 8 cut(s) 24, 39, 169, 218, 330, 410, 419, 492
CviQI GTAC 1 cut(s) 375
DdeI CTNAG 3 cut(s) 156, 337, 366
DpnI GATC 2 cut(s) 73, 176
DpnII GATC 2 cut(s) 71, 174
DrdI GACNNNNNNGTC 1 cut(s) 355
DseDI GACNNNNNNGTC 1 cut(s) 355
Eco47I GGWCC 1 cut(s) 225
Eco81I CCTNAGG 1 cut(s) 366
FaeI CATG 1 cut(s) 202
FaiI YATR 8 cut(s) 124, 126, 134, 144, 153, 200, 248, 404
FaqI GGGAC 2 cut(s) 81, 211
FatI CATG 1 cut(s) 198
FokI GGATG 1 cut(s) 80
FspBI CTAG 2 cut(s) 320, 411
GsaI CCCAGC 2 cut(s) 43, 423
HaeIII GGCC 1 cut(s) 24
Hin1II CATG 1 cut(s) 202
HinfI GANTC 1 cut(s) 380
HphI GGTGA 1 cut(s) 174
Hpy188I TCNGA 5 cut(s) 76, 159, 195, 261, 334
Hpy188III TCNNGA 2 cut(s) 32, 320
HpyAV CCTTC 3 cut(s) 58, 309, 391
HpyF10VI GCNNNNNNNGC 1 cut(s) 416
HpyF3I CTNAG 3 cut(s) 156, 337, 366
Hsp92II CATG 1 cut(s) 202
Kzo9I GATC 2 cut(s) 71, 174
LmnI GCTCC 2 cut(s) 259, 335
LweI GCATC 1 cut(s) 126
MaeI CTAG 2 cut(s) 320, 411
MaeIII GTNAC 3 cut(s) 266, 310, 452
MalI GATC 2 cut(s) 73, 176
MboI GATC 2 cut(s) 71, 174
MflI RGATCY 1 cut(s) 71
MluCI AATT 7 cut(s) 27, 204, 220, 249, 441, 471, 485
MmeI TCCRAC 1 cut(s) 357
MnlI CCTC 5 cut(s) 37, 267, 316, 334, 361
MseI TTAA 3 cut(s) 48, 470, 488
Mva1269I GAATGC 1 cut(s) 62
MwoI GCNNNNNNNGC 1 cut(s) 416
NdeII GATC 2 cut(s) 71, 174
NlaIII CATG 1 cut(s) 202
NlaIV GGNNCC 2 cut(s) 227, 435
NmuCI GTSAC 2 cut(s) 266, 452
PctI GAATGC 1 cut(s) 62
PfeI GAWTC 1 cut(s) 380
PspFI CCCAGC 2 cut(s) 39, 419
PspN4I GGNNCC 2 cut(s) 227, 435
PspPI GGNCC 2 cut(s) 23, 225
PsuI RGATCY 1 cut(s) 71
RsaI GTAC 1 cut(s) 376
RsaNI GTAC 1 cut(s) 375
SaqAI TTAA 3 cut(s) 48, 470, 488
Sau3AI GATC 2 cut(s) 71, 174
Sau96I GGNCC 2 cut(s) 23, 225
ScaI AGTACT 1 cut(s) 376
SetI ASST 7 cut(s) 48, 171, 220, 332, 372, 412, 459
SfaNI GCATC 1 cut(s) 126
SinI GGWCC 1 cut(s) 225
Sse9I AATT 7 cut(s) 27, 204, 220, 249, 441, 471, 485
SspMI CTAG 2 cut(s) 320, 411
TaqI TCGA 1 cut(s) 173
TasI AATT 7 cut(s) 27, 204, 220, 249, 441, 471, 485
TatI WGTACW 1 cut(s) 374
TfiI GAWTC 1 cut(s) 380
Tru1I TTAA 3 cut(s) 48, 470, 488
Tru9I TTAA 3 cut(s) 48, 470, 488
TscAI CASTG 2 cut(s) 300, 457
TseFI GTSAC 2 cut(s) 266, 452
Tsp45I GTSAC 2 cut(s) 266, 452
TspDTI ATGAA 1 cut(s) 215
TspRI CASTG 2 cut(s) 300, 457
VpaK11BI GGWCC 1 cut(s) 225
XapI RAATTY 1 cut(s) 441
XbaI TCTAGA 1 cut(s) 319
XspI CTAG 2 cut(s) 320, 411
ZrmI AGTACT 1 cut(s) 376
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.