MD00G1005800.v1.1

Targeting protein for Xklp2 (TPX2)

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
Physical Location & Seq
Reverse (-)
818654 .. 819933
1280 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1005800.v1.1.491

Sequence Viewer

Length: 333 bp
ATGGTGGAGTCGAGCCGGGATGTGGTGGGGTTCGAGCGGGGATGTGACATAAACTGTGCTGAAAATGAATGGAAAGGGGAAGAGTTCACGAAGAAGCTACAAGAGATGATGATGGAGGAGGATAGACAGCGGAAACCAATTGCTCAGGGCCTCCCATGGACAACTGACGAACTAGAATGCTTACTGAAACCTCCGGTAAAAGAAATAACAATACCAACAGACCTGAAGCTCCACAGTGACATGCGGGCAATAGAGCGAGCAGAGTTTGACCATCAGGTGGCAGAGAAGATGAGCCTGTTGAGCAAAATAAGATGGAAAGAGAAAGACCGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

111

Amino Acids

12.98

Weight (kDa)

5.15

Isoelectric Point (pI)

45.81

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TPX2 PF06886 76 - 104 3e-06 Targeting protein for Xklp2 (TPX2) domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 277
AccBSI CCGCTC 1 cut(s) 37
AciI CCGC 4 cut(s) 37, 130, 244, 328
AcuI CTGAAG 1 cut(s) 245
AfiI CCNNNNNNNGG 2 cut(s) 22, 277
AluBI AGCT 2 cut(s) 97, 229
AluI AGCT 2 cut(s) 97, 229
AoxI GGCC 1 cut(s) 148
AspS9I GGNCC 1 cut(s) 148
AsuC2I CCSGG 1 cut(s) 17
BccI CCATC 3 cut(s) 106, 279, 306
BcnI CCSGG 1 cut(s) 17
BfaI CTAG 1 cut(s) 173
Bme1390I CCNGG 1 cut(s) 17
BmgT120I GGNCC 1 cut(s) 148
BmrFI CCNGG 1 cut(s) 17
Bpu10I CCTNAGC 1 cut(s) 144
BpuMI CCSGG 1 cut(s) 17
BsaJI CCNNGG 1 cut(s) 155
BsaWI WCCGGW 1 cut(s) 193
Bsc4I CCNNNNNNNGG 2 cut(s) 22, 277
BseDI CCNNGG 1 cut(s) 155
BseGI GGATG 2 cut(s) 25, 47
BseLI CCNNNNNNNGG 2 cut(s) 22, 277
BseMII CTCAG 1 cut(s) 158
BseRI GAGGAG 1 cut(s) 131
BshFI GGCC 1 cut(s) 150
BsiSI CCGG 2 cut(s) 16, 194
BslI CCNNNNNNNGG 2 cut(s) 22, 277
BsmI GAATGC 1 cut(s) 182
BsnI GGCC 1 cut(s) 150
Bsp19I CCATGG 1 cut(s) 155
BspACI CCGC 4 cut(s) 37, 130, 244, 328
BspANI GGCC 1 cut(s) 150
BspCNI CTCAG 1 cut(s) 157
BsrBI CCGCTC 1 cut(s) 37
BssECI CCNNGG 1 cut(s) 155
BssT1I CCWWGG 1 cut(s) 155
Bst4CI ACNGT 2 cut(s) 56, 236
Bst6I CTCTTC 1 cut(s) 75
BstC8I GCNNGC 2 cut(s) 246, 258
BstDEI CTNAG 1 cut(s) 144
BstDSI CCRYGG 1 cut(s) 155
BstF5I GGATG 2 cut(s) 25, 47
BstMWI GCNNNNNNNGC 1 cut(s) 300
BstNSI RCATGY 1 cut(s) 244
BstSCI CCNGG 1 cut(s) 15
BsuRI GGCC 1 cut(s) 150
BtgI CCRYGG 1 cut(s) 155
BtsCI GGATG 2 cut(s) 25, 47
BtsIMutI CAGTG 1 cut(s) 241
Cac8I GCNNGC 2 cut(s) 246, 258
Cfr13I GGNCC 1 cut(s) 148
CviAII CATG 2 cut(s) 156, 241
CviJI RGCY 5 cut(s) 15, 97, 150, 229, 294
CviKI_1 RGCY 5 cut(s) 15, 97, 150, 229, 294
DdeI CTNAG 1 cut(s) 144
Eam1104I CTCTTC 1 cut(s) 75
EarI CTCTTC 1 cut(s) 75
Eco130I CCWWGG 1 cut(s) 155
Eco57I CTGAAG 1 cut(s) 245
EcoO109I RGGNCCY 1 cut(s) 148
EcoT14I CCWWGG 1 cut(s) 155
ErhI CCWWGG 1 cut(s) 155
FaeI CATG 2 cut(s) 159, 244
FaiI YATR 3 cut(s) 50, 157, 242
FatI CATG 2 cut(s) 155, 240
FauI CCCGC 2 cut(s) 30, 237
FokI GGATG 2 cut(s) 32, 54
FspBI CTAG 1 cut(s) 173
HaeIII GGCC 1 cut(s) 150
HapII CCGG 2 cut(s) 16, 194
Hin1II CATG 2 cut(s) 159, 244
HinfI GANTC 1 cut(s) 8
HpaII CCGG 2 cut(s) 16, 194
Hpy166II GTNNAC 1 cut(s) 87
Hpy188III TCNNGA 1 cut(s) 88
Hpy8I GTNNAC 1 cut(s) 87
HpyCH4III ACNGT 2 cut(s) 56, 236
HpyF10VI GCNNNNNNNGC 1 cut(s) 300
HpyF3I CTNAG 1 cut(s) 144
Hsp92II CATG 2 cut(s) 159, 244
LmnI GCTCC 1 cut(s) 234
LpnPI CCDG 6 cut(s) 29, 131, 207, 236, 260, 308
MaeI CTAG 1 cut(s) 173
MaeIII GTNAC 2 cut(s) 44, 236
MbiI CCGCTC 1 cut(s) 37
MboII GAAGA 3 cut(s) 92, 103, 298
MfeI CAATTG 1 cut(s) 138
MluCI AATT 1 cut(s) 138
MlyI GAGTC 1 cut(s) 17
MnlI CCTC 4 cut(s) 109, 112, 161, 201
MspA1I CMGCKG 2 cut(s) 130, 330
MspI CCGG 2 cut(s) 16, 194
MspR9I CCNGG 1 cut(s) 17
MunI CAATTG 1 cut(s) 138
Mva1269I GAATGC 1 cut(s) 182
MwoI GCNNNNNNNGC 1 cut(s) 300
NciI CCSGG 1 cut(s) 17
NcoI CCATGG 1 cut(s) 155
NlaIII CATG 2 cut(s) 159, 244
NmuCI GTSAC 2 cut(s) 44, 236
NspI RCATGY 1 cut(s) 244
PctI GAATGC 1 cut(s) 182
PflMI CCANNNNNTGG 1 cut(s) 277
PleI GAGTC 1 cut(s) 16
PpsI GAGTC 1 cut(s) 16
PspPI GGNCC 1 cut(s) 148
Sau96I GGNCC 1 cut(s) 148
SchI GAGTC 1 cut(s) 17
ScrFI CCNGG 1 cut(s) 17
SetI ASST 5 cut(s) 99, 193, 225, 231, 279
Sse9I AATT 1 cut(s) 138
SsiI CCGC 4 cut(s) 37, 130, 244, 328
SspMI CTAG 1 cut(s) 173
StyD4I CCNGG 1 cut(s) 15
StyI CCWWGG 1 cut(s) 155
TaaI ACNGT 2 cut(s) 56, 236
TaqI TCGA 2 cut(s) 11, 33
TasI AATT 1 cut(s) 138
TscAI CASTG 1 cut(s) 241
TseFI GTSAC 2 cut(s) 44, 236
Tsp45I GTSAC 2 cut(s) 44, 236
TspDTI ATGAA 1 cut(s) 81
TspRI CASTG 1 cut(s) 241
Van91I CCANNNNNTGG 1 cut(s) 277
XceI RCATGY 1 cut(s) 244
XspI CTAG 1 cut(s) 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.