MD00G1206900.v1.1

PDDEXK-like family of unknown function

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
OG0010118
Physical Location & Seq
Reverse (-)
50367882 .. 50373947
6066 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1206900.v1.1.491

Sequence Viewer

Length: 273 bp
ATGACTGGTTTTGTTAGAACGAGATTGAAACGGGTCACTTACCCGCTCGACGACCGGGTGAAAGATAGACTCGTAGGAGGATACAGCTCCGGACCTAGTGACGCCAGCAAAGGAAGCGAGCACTCCGACGACTACGACTCCCCTTGCCTCTCCGAGCTCGTCCGCGACTGGGTTTCACGACAACCAGTCGAATCGGGTATTGGGCCGTGGAAGGGGCTTTTTAGTTTCTTCTTTTTCTTCTGTAGGTGTATGGGTAAGGAAGGGACTTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PDDEXK_6

Protein Analysis

91

Amino Acids

10.2

Weight (kDa)

7.71

Isoelectric Point (pI)

37.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 46
AccII CGCG 1 cut(s) 165
AccIII TCCGGA 1 cut(s) 89
AciI CCGC 2 cut(s) 44, 163
AcyI GRCGYC 1 cut(s) 102
AfiI CCNNNNNNNGG 2 cut(s) 169, 212
AgsI TTSAA 1 cut(s) 28
AhdI GACNNNNNGTC 1 cut(s) 185
AjuI GAANNNNNNNTTGG 2 cut(s) 183, 215
AluBI AGCT 2 cut(s) 87, 157
AluI AGCT 2 cut(s) 87, 157
Alw21I GWGCWC 2 cut(s) 123, 159
Aor13HI TCCGGA 1 cut(s) 89
AoxI GGCC 1 cut(s) 203
AspS9I GGNCC 2 cut(s) 92, 203
AsuC2I CCSGG 1 cut(s) 56
AsuHPI GGTGA 1 cut(s) 70
AvaII GGWCC 1 cut(s) 92
BanII GRGCYC 1 cut(s) 159
Bbv12I GWGCWC 2 cut(s) 123, 159
BceAI ACGGC 1 cut(s) 190
BciVI GTATCC 1 cut(s) 74
BcnI CCSGG 1 cut(s) 56
BfaI CTAG 1 cut(s) 96
BfmI CTRYAG 1 cut(s) 241
BfuI GTATCC 1 cut(s) 74
Bme1390I CCNGG 1 cut(s) 56
Bme18I GGWCC 1 cut(s) 92
BmeRI GACNNNNNGTC 1 cut(s) 185
BmgT120I GGNCC 2 cut(s) 92, 203
BmrFI CCNGG 1 cut(s) 56
BmrI ACTGGG 1 cut(s) 178
BmuI ACTGGG 1 cut(s) 178
BpuMI CCSGG 1 cut(s) 56
BsaHI GRCGYC 1 cut(s) 102
BsaJI CCNNGG 1 cut(s) 206
BsaWI WCCGGW 1 cut(s) 89
BsaXI ACNNNNNCTCC 2 cut(s) 122, 152
Bsc4I CCNNNNNNNGG 2 cut(s) 169, 212
Bse1I ACTGG 3 cut(s) 10, 173, 185
BseAI TCCGGA 1 cut(s) 89
BseDI CCNNGG 1 cut(s) 206
BseLI CCNNNNNNNGG 2 cut(s) 169, 212
BseNI ACTGG 3 cut(s) 10, 173, 185
Bsh1236I CGCG 1 cut(s) 165
Bsh1285I CGRYCG 1 cut(s) 55
BshFI GGCC 1 cut(s) 205
BsiEI CGRYCG 1 cut(s) 55
BsiHKAI GWGCWC 2 cut(s) 123, 159
BsiSI CCGG 2 cut(s) 55, 90
BslI CCNNNNNNNGG 2 cut(s) 169, 212
BsnI GGCC 1 cut(s) 205
Bsp1286I GDGCHC 2 cut(s) 123, 159
Bsp13I TCCGGA 1 cut(s) 89
BspACI CCGC 2 cut(s) 44, 163
BspANI GGCC 1 cut(s) 205
BspEI TCCGGA 1 cut(s) 89
BspFNI CGCG 1 cut(s) 165
BsrBI CCGCTC 1 cut(s) 46
BsrI ACTGG 3 cut(s) 10, 173, 185
BssECI CCNNGG 1 cut(s) 206
BssNI GRCGYC 1 cut(s) 102
BstACI GRCGYC 1 cut(s) 102
BstC8I GCNNGC 2 cut(s) 106, 119
BstDSI CCRYGG 1 cut(s) 206
BstFNI CGCG 1 cut(s) 165
BstMCI CGRYCG 1 cut(s) 55
BstMWI GCNNNNNNNGC 1 cut(s) 114
BstSCI CCNGG 1 cut(s) 54
BstSFI CTRYAG 1 cut(s) 241
BstUI CGCG 1 cut(s) 165
BsuI GTATCC 1 cut(s) 74
BsuRI GGCC 1 cut(s) 205
BtgI CCRYGG 1 cut(s) 206
Cac8I GCNNGC 2 cut(s) 106, 119
Cfr13I GGNCC 2 cut(s) 92, 203
CseI GACGC 1 cut(s) 110
CviJI RGCY 4 cut(s) 87, 157, 205, 217
CviKI_1 RGCY 4 cut(s) 87, 157, 205, 217
DriI GACNNNNNGTC 1 cut(s) 185
Eam1105I GACNNNNNGTC 1 cut(s) 185
Ecl136II GAGCTC 1 cut(s) 157
Eco24I GRGCYC 1 cut(s) 159
Eco47I GGWCC 1 cut(s) 92
Eco53kI GAGCTC 1 cut(s) 157
EcoICRI GAGCTC 1 cut(s) 157
EcoT38I GRGCYC 1 cut(s) 159
FaiI YATR 1 cut(s) 251
FauI CCCGC 1 cut(s) 51
FriOI GRGCYC 1 cut(s) 159
FspBI CTAG 1 cut(s) 96
HaeIII GGCC 1 cut(s) 205
HapII CCGG 2 cut(s) 55, 90
HgaI GACGC 1 cut(s) 110
Hin1I GRCGYC 1 cut(s) 102
HinfI GANTC 3 cut(s) 69, 137, 191
HpaII CCGG 2 cut(s) 55, 90
HphI GGTGA 1 cut(s) 70
Hpy188I TCNGA 2 cut(s) 127, 154
Hpy188III TCNNGA 2 cut(s) 90, 177
Hpy99I CGWCG 2 cut(s) 53, 131
HpyAV CCTTC 2 cut(s) 205, 254
HpyF10VI GCNNNNNNNGC 1 cut(s) 114
Hsp92I GRCGYC 1 cut(s) 102
Kpn2I TCCGGA 1 cut(s) 89
LmnI GCTCC 1 cut(s) 92
LpnPI CCDG 5 cut(s) 68, 103, 118, 154, 198
MaeI CTAG 1 cut(s) 96
MaeIII GTNAC 2 cut(s) 34, 98
MbiI CCGCTC 1 cut(s) 46
MboII GAAGA 2 cut(s) 220, 229
MhlI GDGCHC 2 cut(s) 123, 159
MlyI GAGTC 2 cut(s) 63, 131
MmeI TCCRAC 1 cut(s) 150
MnlI CCTC 2 cut(s) 71, 158
MroI TCCGGA 1 cut(s) 89
MseI TTAA 1 cut(s) 271
MspI CCGG 2 cut(s) 55, 90
MspR9I CCNGG 1 cut(s) 56
MvnI CGCG 1 cut(s) 165
MwoI GCNNNNNNNGC 1 cut(s) 114
NciI CCSGG 1 cut(s) 56
NmuCI GTSAC 2 cut(s) 34, 98
PfeI GAWTC 1 cut(s) 191
PleI GAGTC 2 cut(s) 63, 131
PpsI GAGTC 2 cut(s) 63, 131
Psp124BI GAGCTC 1 cut(s) 159
PspPI GGNCC 2 cut(s) 92, 203
SacI GAGCTC 1 cut(s) 159
SaqAI TTAA 1 cut(s) 271
Sau96I GGNCC 2 cut(s) 92, 203
SchI GAGTC 2 cut(s) 63, 131
ScrFI CCNGG 1 cut(s) 56
SduI GDGCHC 2 cut(s) 123, 159
SetI ASST 4 cut(s) 89, 97, 159, 248
SfcI CTRYAG 1 cut(s) 241
SinI GGWCC 1 cut(s) 92
SsiI CCGC 2 cut(s) 44, 163
SspMI CTAG 1 cut(s) 96
SstI GAGCTC 1 cut(s) 159
StyD4I CCNGG 1 cut(s) 54
TaqI TCGA 2 cut(s) 48, 189
TfiI GAWTC 1 cut(s) 191
Tru1I TTAA 1 cut(s) 271
Tru9I TTAA 1 cut(s) 271
TseFI GTSAC 2 cut(s) 34, 98
Tsp45I GTSAC 2 cut(s) 34, 98
VpaK11BI GGWCC 1 cut(s) 92
XspI CTAG 1 cut(s) 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.