MD01G1112000.v1.1

LRR receptor-like serine threonine-protein kinase At3g47570

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr01
Physical Location & Seq
Reverse (-)
22609402 .. 22609767
366 bp
Loading structure...
UTR
Exon/CDS
Intron
MD01G1112000.v1.1.491

Sequence Viewer

Length: 366 bp
ATGGGAAGTTTTGGGTCAGTTTATAAAGGATTACTTGATCAAGGTGAAACAACAATTGCTACCAAGGTACTCAACCTTGATCGACACAGAGCTTCCAAAAGTTTCATTGCTGAGTGTGAGGCTCTGAAAAATATTAGACACCGTAACCTTGTGAAGGTAGTTTCTGCATGCTCTAGATTCGACTATCGTGGTTCTAATTTCAAGGCCTTAGTTTACGAGTTCATGGCAAATGGGAGCTTAGAAGAATGGTTGCATCCAACTCAGACAAGTATCGAGATGAATGAGAGGGCAAGGTGCTTAACTTTTTCTCAGAGGTTGAACATTGCTATAGATGTTGCAATGGCATTGGATTATCTCGATCATTAA

Protein Analysis

122

Amino Acids

13.75

Weight (kDa)

7.76

Isoelectric Point (pI)

30.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PK_Tyr_Ser-Thr PF07714 2 - 120 2.2e-17 Protein tyrosine and serine/threonine kinase
Pkinase PF00069 2 - 119 3.1e-12 Protein kinase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 24
AfaI GTAC 1 cut(s) 69
AfiI CCNNNNNNNGG 1 cut(s) 154
AgsI TTSAA 2 cut(s) 202, 319
AluBI AGCT 2 cut(s) 92, 237
AluI AGCT 2 cut(s) 92, 237
AoxI GGCC 1 cut(s) 204
AsuHPI GGTGA 1 cut(s) 56
BclI TGATCA 1 cut(s) 37
BfaI CTAG 1 cut(s) 174
BfmI CTRYAG 1 cut(s) 327
BmsI GCATC 1 cut(s) 262
BsaJI CCNNGG 1 cut(s) 63
Bsc4I CCNNNNNNNGG 1 cut(s) 154
Bse3DI GCAATG 3 cut(s) 105, 321, 345
BseDI CCNNGG 1 cut(s) 63
BseGI GGATG 1 cut(s) 253
BseLI CCNNNNNNNGG 1 cut(s) 154
BseMI GCAATG 3 cut(s) 105, 321, 345
BseMII CTCAG 3 cut(s) 102, 275, 323
BshFI GGCC 1 cut(s) 206
BslI CCNNNNNNNGG 1 cut(s) 154
BsnI GGCC 1 cut(s) 206
Bsp143I GATC 3 cut(s) 37, 79, 358
BspANI GGCC 1 cut(s) 206
BspCNI CTCAG 3 cut(s) 103, 274, 322
BsrDI GCAATG 3 cut(s) 105, 321, 345
BssECI CCNNGG 1 cut(s) 63
BssMI GATC 3 cut(s) 37, 79, 358
BssT1I CCWWGG 1 cut(s) 63
Bst4CI ACNGT 1 cut(s) 143
BstC8I GCNNGC 1 cut(s) 169
BstDEI CTNAG 5 cut(s) 111, 208, 238, 261, 309
BstENI CCTNNNNNAGG 1 cut(s) 152
BstF5I GGATG 1 cut(s) 253
BstKTI GATC 3 cut(s) 40, 82, 361
BstMBI GATC 3 cut(s) 37, 79, 358
BstNSI RCATGY 1 cut(s) 171
BstSFI CTRYAG 1 cut(s) 327
BsuRI GGCC 1 cut(s) 206
BtsCI GGATG 1 cut(s) 253
Cac8I GCNNGC 1 cut(s) 169
Csp6I GTAC 1 cut(s) 68
CviAII CATG 2 cut(s) 168, 223
CviJI RGCY 4 cut(s) 92, 122, 206, 237
CviKI_1 RGCY 4 cut(s) 92, 122, 206, 237
CviQI GTAC 1 cut(s) 68
DdeI CTNAG 5 cut(s) 111, 208, 238, 261, 309
DpnI GATC 3 cut(s) 39, 81, 360
DpnII GATC 3 cut(s) 37, 79, 358
Eco130I CCWWGG 1 cut(s) 63
Eco147I AGGCCT 1 cut(s) 206
EcoNI CCTNNNNNAGG 1 cut(s) 152
EcoT14I CCWWGG 1 cut(s) 63
ErhI CCWWGG 1 cut(s) 63
FaeI CATG 2 cut(s) 171, 226
FaiI YATR 4 cut(s) 24, 169, 224, 329
FalI AAGNNNNNCTT 2 cut(s) 18, 50
FatI CATG 2 cut(s) 167, 222
FbaI TGATCA 1 cut(s) 37
FokI GGATG 1 cut(s) 240
FspBI CTAG 1 cut(s) 174
HaeIII GGCC 1 cut(s) 206
Hin1II CATG 2 cut(s) 171, 226
HinfI GANTC 1 cut(s) 177
HphI GGTGA 1 cut(s) 56
Hpy166II GTNNAC 1 cut(s) 214
Hpy188I TCNGA 3 cut(s) 126, 264, 312
Hpy188III TCNNGA 3 cut(s) 174, 274, 356
Hpy8I GTNNAC 1 cut(s) 214
HpyAV CCTTC 1 cut(s) 148
HpyCH4III ACNGT 1 cut(s) 143
HpyCH4V TGCA 3 cut(s) 167, 253, 338
HpyF3I CTNAG 5 cut(s) 111, 208, 238, 261, 309
Hsp92II CATG 2 cut(s) 171, 226
Ksp22I TGATCA 1 cut(s) 37
Kzo9I GATC 3 cut(s) 37, 79, 358
LmnI GCTCC 1 cut(s) 234
LweI GCATC 1 cut(s) 262
MaeI CTAG 1 cut(s) 174
MaeIII GTNAC 1 cut(s) 143
MalI GATC 3 cut(s) 39, 81, 360
MboI GATC 3 cut(s) 37, 79, 358
MboII GAAGA 1 cut(s) 254
MfeI CAATTG 1 cut(s) 54
MluCI AATT 2 cut(s) 54, 196
MmeI TCCRAC 1 cut(s) 281
MnlI CCTC 3 cut(s) 112, 279, 306
MseI TTAA 2 cut(s) 299, 364
MunI CAATTG 1 cut(s) 54
NdeII GATC 3 cut(s) 37, 79, 358
NlaIII CATG 2 cut(s) 171, 226
NspI RCATGY 1 cut(s) 171
PaeI GCATGC 1 cut(s) 171
PceI AGGCCT 1 cut(s) 206
PfeI GAWTC 1 cut(s) 177
PsiI TTATAA 1 cut(s) 24
RsaI GTAC 1 cut(s) 69
RsaNI GTAC 1 cut(s) 68
SaqAI TTAA 2 cut(s) 299, 364
Sau3AI GATC 3 cut(s) 37, 79, 358
SetI ASST 9 cut(s) 46, 69, 78, 94, 150, 159, 239, 296, 317
SfaNI GCATC 1 cut(s) 262
SfcI CTRYAG 1 cut(s) 327
SphI GCATGC 1 cut(s) 171
Sse9I AATT 2 cut(s) 54, 196
SseBI AGGCCT 1 cut(s) 206
SspI AATATT 1 cut(s) 133
SspMI CTAG 1 cut(s) 174
StuI AGGCCT 1 cut(s) 206
StyI CCWWGG 1 cut(s) 63
TaaI ACNGT 1 cut(s) 143
TaqI TCGA 4 cut(s) 82, 180, 273, 357
TasI AATT 2 cut(s) 54, 196
TfiI GAWTC 1 cut(s) 177
Tru1I TTAA 2 cut(s) 299, 364
Tru9I TTAA 2 cut(s) 299, 364
TspDTI ATGAA 3 cut(s) 94, 211, 293
XagI CCTNNNNNAGG 1 cut(s) 152
XbaI TCTAGA 1 cut(s) 173
XceI RCATGY 1 cut(s) 171
XspI CTAG 1 cut(s) 174
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.