Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr01

Orthogroup ID

OG0005074

Physical Location & Seq

Genomic Coordinates Reverse (-)

22974501 .. 22975813

Gene Structure 1313 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD01G1115900.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 174 bp

ATGGGTCTACCTACTGAACCGTATGAGTGGTACATTGACTTGCCACACTTTGGGACCATCAAACATTATGGTTTTGGTTTAGGATTCGAACGGATGATTTTATTTGCTACCAGCATTGACCACATTAGAGATGCTATTCCTTTCCCTAGACATCCAGGAAGAACAAATCTTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0003006 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0005829 GO:0007275 GO:0008150 GO:0009507 GO:0009536 GO:0009790 GO:0009791 GO:0009793 GO:0010035 GO:0010038 GO:0010154 GO:0022414 GO:0032501 GO:0032502 GO:0042221 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464 GO:0046686 GO:0048316 GO:0048608 GO:0048731 GO:0048856 GO:0050896 GO:0061458

KEGG Pathways

Metabolic & Signaling

ko00970 map00970

Pfam Domains

Protein Families

WHEP-TRS tRNA-synt_2 tRNA_anti-codon

Protein Analysis

58

Amino Acids

6.64

Weight (kDa)

6.38

Isoelectric Point (pI)

37.06

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
tRNA-synt_2	PF00152	6 - 51	8.3e-11	tRNA synthetases class II (D, K and N)

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005074)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G70980 AT5G56680
fragaria_vesca	FvH4_3g17430
malus_domestica	MD01G1115900.v1.1 MD03G1251800.v1.1 MD05G1158600.v1.1 MD11G1273000.v1.1
prunus_persica	Prupe.4G154500_v2.0.a1 Prupe.4G154500_v2.0.a1 Prupe.7G068600_v2.0.a1 Prupe.7G068600_v2.0.a1 Prupe.7G068600_v2.0.a1 Prupe.7G068600_v2.0.a1 Prupe.7G068600_v2.0.a1
pyrus_communis	pycom03g19910 pycom05g15060 pycom11g24090
rosa_chinensis	RchiOBHm_Chr5g0028961
rosa_laevigata	RLG00000033131
rosa_multiflora	Rmu_co7984584.1_g000001 Rmu_sc0009042.1_g000005
rosa_roxburghii	Rroxscaffold_1G00050930
rosa_rugosa	Rorug05G0111900 Rorug05G0112000 Rorug05G0112000
rosa_samantha	Rh5AG204000 Rh5BG202300 Rh5CG223100 Rh5DG206100
rosa_wichuraiana	Rw5G018490

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	50
AccI	GTMKAC	1 cut(s)	7
AfaI	GTAC	1 cut(s)	32
AfiI	CCNNNNNNNGG	1 cut(s)	50
AjnI	CCWGG	1 cut(s)	154
AspS9I	GGNCC	1 cut(s)	54
AsuII	TTCGAA	1 cut(s)	87
AvaII	GGWCC	1 cut(s)	54
BccI	CCATC	1 cut(s)	65
BciT130I	CCWGG	1 cut(s)	156
BfaI	CTAG	1 cut(s)	147
Bme1390I	CCNGG	1 cut(s)	156
Bme18I	GGWCC	1 cut(s)	54
BmgT120I	GGNCC	1 cut(s)	54
BmiI	GGNNCC	1 cut(s)	55
BmrFI	CCNGG	1 cut(s)	156
BmsI	GCATC	1 cut(s)	121
Bpu14I	TTCGAA	1 cut(s)	87
Bsc4I	CCNNNNNNNGG	1 cut(s)	50
BseBI	CCWGG	1 cut(s)	156
BseGI	GGATG	2 cut(s)	99, 151
BseLI	CCNNNNNNNGG	1 cut(s)	50
BslFI	GGGAC	1 cut(s)	67
BslI	CCNNNNNNNGG	1 cut(s)	50
BsmFI	GGGAC	1 cut(s)	67
Bsp119I	TTCGAA	1 cut(s)	87
BspLI	GGNNCC	1 cut(s)	55
BspT104I	TTCGAA	1 cut(s)	87
Bst2UI	CCWGG	1 cut(s)	156
Bst4CI	ACNGT	1 cut(s)	21
BstBI	TTCGAA	1 cut(s)	87
BstF5I	GGATG	2 cut(s)	99, 151
BstNI	CCWGG	1 cut(s)	156
BstSCI	CCNGG	1 cut(s)	154
BtsCI	GGATG	2 cut(s)	99, 151
Cfr13I	GGNCC	1 cut(s)	54
Csp6I	GTAC	1 cut(s)	31
CviQI	GTAC	1 cut(s)	31
Eco47I	GGWCC	1 cut(s)	54
EcoRII	CCWGG	1 cut(s)	154
FaiI	YATR	2 cut(s)	24, 69
FaqI	GGGAC	1 cut(s)	67
FblI	GTMKAC	1 cut(s)	7
FokI	GGATG	2 cut(s)	106, 138
FspBI	CTAG	1 cut(s)	147
HinfI	GANTC	1 cut(s)	84
Hpy166II	GTNNAC	1 cut(s)	8
Hpy8I	GTNNAC	1 cut(s)	8
HpyCH4III	ACNGT	1 cut(s)	21
LpnPI	CCDG	3 cut(s)	124, 141, 168
LweI	GCATC	1 cut(s)	121
MaeI	CTAG	1 cut(s)	147
MboII	GAAGA	1 cut(s)	171
MspR9I	CCNGG	1 cut(s)	156
MvaI	CCWGG	1 cut(s)	156
NlaIV	GGNNCC	1 cut(s)	55
NspV	TTCGAA	1 cut(s)	87
PfeI	GAWTC	1 cut(s)	84
PflMI	CCANNNNNTGG	1 cut(s)	50
PfoI	TCCNGGA	1 cut(s)	154
Psp6I	CCWGG	1 cut(s)	154
PspGI	CCWGG	1 cut(s)	154
PspN4I	GGNNCC	1 cut(s)	55
PspPI	GGNCC	1 cut(s)	54
RsaI	GTAC	1 cut(s)	32
RsaNI	GTAC	1 cut(s)	31
Sau96I	GGNCC	1 cut(s)	54
ScrFI	CCNGG	1 cut(s)	156
SetI	ASST	1 cut(s)	13
SfaNI	GCATC	1 cut(s)	121
SfuI	TTCGAA	1 cut(s)	87
SgeI	CNNG	5 cut(s)	52, 123, 159, 167, 168
SinI	GGWCC	1 cut(s)	54
SspMI	CTAG	1 cut(s)	147
StyD4I	CCNGG	1 cut(s)	154
TaaI	ACNGT	1 cut(s)	21
TaqI	TCGA	1 cut(s)	87
TfiI	GAWTC	1 cut(s)	84
TspGWI	ACGGA	1 cut(s)	106
Van91I	CCANNNNNTGG	1 cut(s)	50
VpaK11BI	GGWCC	1 cut(s)	54
XmiI	GTMKAC	1 cut(s)	7
XspI	CTAG	1 cut(s)	147

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.