MD03G1032000.v1.1

Coiled-coil domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr03
OG0002738
Physical Location & Seq
Reverse (-)
2571018 .. 2571798
781 bp
Loading structure...
UTR
Exon/CDS
Intron
MD03G1032000.v1.1.491

Sequence Viewer

Length: 498 bp
ATGCAACTTCTAGGTCATATTGTCTATGCTCCTGCTGTCTTCAAAACTTCTGTGGAGGAGGAACTTTCTAAACTGTCAACGGATCTAGAGAAGCAGCCCAAGGTGGCATCTAGAAAGTCCTACATTGAAGGGGTCAAGGAGATCACAAAGAACAGTCGGAAGCAAGAAGCTGACATACAGCAGATCTTAAAAGACACCAGGGAGCTTCAGTTAGAGAGTAATTCTATTCAAGAACGTCTTCATCGGACATATGCTGTTGTAGATGAAATGGTGTTCAGGGAAGCAAAGAAGGATGCAGTTGGGAAGCAGGCTTATAGGCTTCTCACTAGCATCCACGAGAGCTTCGAACAGATTCGTGAGAAAATTATGGCAACTGATAGAATCCGACGAGAAGTAGGTGAACATAAAAAGAAGCTAGTGGCCATGGCCTCGCGAAGCTTAAATGTAGACAAACTACAAGCCGATCTTGATGCCATCAGGAGGGAAAATGATTATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF812

Protein Analysis

166

Amino Acids

19.16

Weight (kDa)

9.0

Isoelectric Point (pI)

46.15

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CCDC22_CC PF05667 19 - 138 4.5e-36 CCDC22 protein coiled-coil region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 447
AccII CGCG 1 cut(s) 433
AclWI GGATC 1 cut(s) 90
AcoI YGGCCR 1 cut(s) 420
AcuI CTGAAG 1 cut(s) 191
AfiI CCNNNNNNNGG 1 cut(s) 480
AgsI TTSAA 3 cut(s) 43, 128, 230
AjnI CCWGG 1 cut(s) 197
AluBI AGCT 5 cut(s) 170, 205, 342, 415, 438
AluI AGCT 5 cut(s) 170, 205, 342, 415, 438
AlwI GGATC 1 cut(s) 90
AoxI GGCC 2 cut(s) 420, 426
ApeKI GCWGC 1 cut(s) 94
Asp700I GAANNNNTTC 2 cut(s) 237, 351
AsuHPI GGTGA 1 cut(s) 410
AsuII TTCGAA 1 cut(s) 345
BalI TGGCCA 1 cut(s) 422
BarI GAAGNNNNNNTAC 2 cut(s) 159, 191
BauI CACGAG 1 cut(s) 335
BbsI GAAGAC 2 cut(s) 31, 230
BbvI GCAGC 1 cut(s) 106
BccI CCATC 1 cut(s) 482
BcgI CGANNNNNNTGC 2 cut(s) 452, 486
BciT130I CCWGG 1 cut(s) 199
BfaI CTAG 5 cut(s) 11, 86, 111, 327, 416
BglII AGATCT 1 cut(s) 183
BisI GCNGC 1 cut(s) 95
BlsI GCNGC 1 cut(s) 96
Bme1390I CCNGG 1 cut(s) 199
BmrFI CCNGG 1 cut(s) 199
BmsI GCATC 4 cut(s) 116, 283, 339, 460
BpiI GAAGAC 2 cut(s) 31, 230
Bpu14I TTCGAA 1 cut(s) 345
BsaJI CCNNGG 3 cut(s) 99, 198, 423
BsaXI ACNNNNNCTCC 2 cut(s) 194, 224
Bsc4I CCNNNNNNNGG 1 cut(s) 480
BseBI CCWGG 1 cut(s) 199
BseDI CCNNGG 3 cut(s) 99, 198, 423
BseGI GGATG 2 cut(s) 298, 330
BseLI CCNNNNNNNGG 1 cut(s) 480
BseRI GAGGAG 1 cut(s) 71
BseXI GCAGC 1 cut(s) 106
Bsh1236I CGCG 1 cut(s) 433
BshFI GGCC 2 cut(s) 422, 428
BslI CCNNNNNNNGG 1 cut(s) 480
BsnI GGCC 2 cut(s) 422, 428
Bsp119I TTCGAA 1 cut(s) 345
Bsp143I GATC 4 cut(s) 82, 141, 183, 463
Bsp19I CCATGG 1 cut(s) 423
Bsp68I TCGCGA 1 cut(s) 433
BspANI GGCC 2 cut(s) 422, 428
BspFNI CGCG 1 cut(s) 433
BspPI GGATC 1 cut(s) 90
BspT104I TTCGAA 1 cut(s) 345
BssECI CCNNGG 3 cut(s) 99, 198, 423
BssMI GATC 4 cut(s) 82, 141, 183, 463
BssSI CACGAG 1 cut(s) 335
BssT1I CCWWGG 2 cut(s) 99, 423
Bst2BI CACGAG 1 cut(s) 335
Bst2UI CCWGG 1 cut(s) 199
Bst4CI ACNGT 2 cut(s) 75, 155
BstBI TTCGAA 1 cut(s) 345
BstC8I GCNNGC 1 cut(s) 309
BstDSI CCRYGG 1 cut(s) 423
BstF5I GGATG 2 cut(s) 298, 330
BstFNI CGCG 1 cut(s) 433
BstKTI GATC 4 cut(s) 85, 144, 186, 466
BstMBI GATC 4 cut(s) 82, 141, 183, 463
BstNI CCWGG 1 cut(s) 199
BstSCI CCNGG 1 cut(s) 197
BstUI CGCG 1 cut(s) 433
BstV1I GCAGC 1 cut(s) 106
BstV2I GAAGAC 2 cut(s) 31, 230
BstX2I RGATCY 2 cut(s) 82, 183
BstYI RGATCY 2 cut(s) 82, 183
BsuRI GGCC 2 cut(s) 422, 428
BtgI CCRYGG 1 cut(s) 423
BtsCI GGATG 2 cut(s) 298, 330
BtuMI TCGCGA 1 cut(s) 433
Cac8I GCNNGC 1 cut(s) 309
CviAII CATG 1 cut(s) 424
DpnI GATC 4 cut(s) 84, 143, 185, 465
DpnII GATC 4 cut(s) 82, 141, 183, 463
EaeI YGGCCR 1 cut(s) 420
Eco130I CCWWGG 2 cut(s) 99, 423
Eco57I CTGAAG 1 cut(s) 191
EcoRII CCWGG 1 cut(s) 197
EcoT14I CCWWGG 2 cut(s) 99, 423
ErhI CCWWGG 2 cut(s) 99, 423
FaeI CATG 1 cut(s) 427
FaiI YATR 9 cut(s) 18, 27, 176, 250, 252, 315, 368, 405, 425
FalI AAGNNNNNCTT 4 cut(s) 222, 254, 450, 482
FatI CATG 1 cut(s) 423
FauNDI CATATG 1 cut(s) 250
FblI GTMKAC 1 cut(s) 447
Fnu4HI GCNGC 1 cut(s) 95
FokI GGATG 2 cut(s) 305, 317
Fsp4HI GCNGC 1 cut(s) 95
FspBI CTAG 5 cut(s) 11, 86, 111, 327, 416
GluI GCNGC 1 cut(s) 95
HaeIII GGCC 2 cut(s) 422, 428
Hin1II CATG 1 cut(s) 427
HincII GTYRAC 1 cut(s) 78
HindII GTYRAC 1 cut(s) 78
HindIII AAGCTT 1 cut(s) 436
HinfI GANTC 2 cut(s) 352, 381
HphI GGTGA 1 cut(s) 410
Hpy166II GTNNAC 3 cut(s) 78, 401, 448
Hpy188I TCNGA 3 cut(s) 159, 246, 386
Hpy188III TCNNGA 7 cut(s) 86, 111, 230, 356, 432, 467, 478
Hpy8I GTNNAC 3 cut(s) 78, 401, 448
Hpy99I CGWCG 1 cut(s) 390
HpyAV CCTTC 2 cut(s) 122, 283
HpyCH4III ACNGT 2 cut(s) 75, 155
HpyCH4IV ACGT 1 cut(s) 235
HpyCH4V TGCA 2 cut(s) 4, 296
HpySE526I ACGT 1 cut(s) 235
Hsp92II CATG 1 cut(s) 427
Kzo9I GATC 4 cut(s) 82, 141, 183, 463
LmnI GCTCC 2 cut(s) 34, 202
LpnPI CCDG 6 cut(s) 45, 184, 211, 262, 293, 463
Lsp1109I GCAGC 1 cut(s) 106
LweI GCATC 4 cut(s) 116, 283, 339, 460
MaeI CTAG 5 cut(s) 11, 86, 111, 327, 416
MaeII ACGT 1 cut(s) 235
MalI GATC 4 cut(s) 84, 143, 185, 465
MboI GATC 4 cut(s) 82, 141, 183, 463
MboII GAAGA 2 cut(s) 31, 230
MflI RGATCY 2 cut(s) 82, 183
MlsI TGGCCA 1 cut(s) 422
MluCI AATT 2 cut(s) 220, 363
MluNI TGGCCA 1 cut(s) 422
MmeI TCCRAC 2 cut(s) 137, 409
MnlI CCTC 4 cut(s) 49, 52, 439, 474
Mox20I TGGCCA 1 cut(s) 422
MroXI GAANNNNTTC 2 cut(s) 237, 351
MscI TGGCCA 1 cut(s) 422
MseI TTAA 3 cut(s) 188, 440, 496
Msp20I TGGCCA 1 cut(s) 422
MspR9I CCNGG 1 cut(s) 199
MvaI CCWGG 1 cut(s) 199
MvnI CGCG 1 cut(s) 433
NcoI CCATGG 1 cut(s) 423
NdeI CATATG 1 cut(s) 250
NdeII GATC 4 cut(s) 82, 141, 183, 463
NlaIII CATG 1 cut(s) 427
NruI TCGCGA 1 cut(s) 433
NspV TTCGAA 1 cut(s) 345
PcsI WCGNNNNNNNCGW 1 cut(s) 342
PdmI GAANNNNTTC 2 cut(s) 237, 351
PfeI GAWTC 2 cut(s) 352, 381
PkrI GCNGC 1 cut(s) 96
Psp6I CCWGG 1 cut(s) 197
PspGI CCWGG 1 cut(s) 197
PsuI RGATCY 2 cut(s) 82, 183
RruI TCGCGA 1 cut(s) 433
SaqAI TTAA 3 cut(s) 188, 440, 496
SatI GCNGC 1 cut(s) 95
Sau3AI GATC 4 cut(s) 82, 141, 183, 463
ScrFI CCNGG 1 cut(s) 199
SetI ASST 9 cut(s) 16, 105, 172, 207, 238, 344, 400, 417, 440
SfaNI GCATC 4 cut(s) 116, 283, 339, 460
SfuI TTCGAA 1 cut(s) 345
Sse9I AATT 2 cut(s) 220, 363
SspMI CTAG 5 cut(s) 11, 86, 111, 327, 416
StyD4I CCNGG 1 cut(s) 197
StyI CCWWGG 2 cut(s) 99, 423
TaaI ACNGT 2 cut(s) 75, 155
TaiI ACGT 1 cut(s) 238
TaqI TCGA 1 cut(s) 345
TasI AATT 2 cut(s) 220, 363
TfiI GAWTC 2 cut(s) 352, 381
Tru1I TTAA 3 cut(s) 188, 440, 496
Tru9I TTAA 3 cut(s) 188, 440, 496
TseI GCWGC 1 cut(s) 94
TspDTI ATGAA 2 cut(s) 230, 279
TspGWI ACGGA 1 cut(s) 95
XbaI TCTAGA 2 cut(s) 85, 110
XmiI GTMKAC 1 cut(s) 447
XmnI GAANNNNTTC 2 cut(s) 237, 351
XspI CTAG 5 cut(s) 11, 86, 111, 327, 416
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.