Rroxscaffold_4G00290220

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
10753652 .. 10754233
582 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00290220.1

Sequence Viewer

Length: 225 bp
ATGGCTTCGGGATCAACAGCCTCGGCTACCCGGCGACGTGAGCTTCCACAAGTTGGTGAGGTTCTTGGTGGAGAGGCTTTCGGAGTTGTCGGGAGTGGAAGCGGGGGTGGTGTCGACGGTGTTGAGGATATGGGGAGAGTGAAAGAAGATAGCTTTGAAAGCAATGTGGAGAACCACGAAGCGGTGATGACAGACTTGGACCAAAATGGGATGAATTCACATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

7.61

Weight (kDa)

4.38

Isoelectric Point (pI)

37.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 53
AccI GTMKAC 1 cut(s) 114
AciI CCGC 2 cut(s) 102, 182
AclWI GGATC 1 cut(s) 19
AcsI RAATTY 1 cut(s) 214
AfiI CCNNNNNNNGG 2 cut(s) 53, 181
AgsI TTSAA 1 cut(s) 158
AjiI CACGTC 1 cut(s) 38
AluBI AGCT 2 cut(s) 43, 153
AluI AGCT 2 cut(s) 43, 153
AlwI GGATC 1 cut(s) 19
ApoI RAATTY 1 cut(s) 214
AspS9I GGNCC 1 cut(s) 199
AsuC2I CCSGG 1 cut(s) 31
AsuHPI GGTGA 2 cut(s) 68, 196
AvaII GGWCC 1 cut(s) 199
BcnI CCSGG 1 cut(s) 31
Bme1390I CCNGG 1 cut(s) 31
Bme18I GGWCC 1 cut(s) 199
BmgBI CACGTC 1 cut(s) 38
BmgT120I GGNCC 1 cut(s) 199
BmrFI CCNGG 1 cut(s) 31
BpuMI CCSGG 1 cut(s) 31
BsaJI CCNNGG 1 cut(s) 21
Bsc4I CCNNNNNNNGG 2 cut(s) 53, 181
Bse3DI GCAATG 1 cut(s) 169
BseDI CCNNGG 1 cut(s) 21
BseGI GGATG 1 cut(s) 216
BseLI CCNNNNNNNGG 2 cut(s) 53, 181
BseMI GCAATG 1 cut(s) 169
BsiSI CCGG 1 cut(s) 31
BslI CCNNNNNNNGG 2 cut(s) 53, 181
Bsp143I GATC 1 cut(s) 11
BspACI CCGC 2 cut(s) 102, 182
BspPI GGATC 1 cut(s) 19
BsrDI GCAATG 1 cut(s) 169
BssECI CCNNGG 1 cut(s) 21
BssMI GATC 1 cut(s) 11
Bst4CI ACNGT 1 cut(s) 119
BstF5I GGATG 1 cut(s) 216
BstKTI GATC 1 cut(s) 14
BstMBI GATC 1 cut(s) 11
BstMWI GCNNNNNNNGC 2 cut(s) 40, 159
BstSCI CCNGG 1 cut(s) 29
BtrI CACGTC 1 cut(s) 38
BtsCI GGATG 1 cut(s) 216
Cfr13I GGNCC 1 cut(s) 199
CviJI RGCY 6 cut(s) 5, 20, 26, 43, 77, 153
CviKI_1 RGCY 6 cut(s) 5, 20, 26, 43, 77, 153
DpnI GATC 1 cut(s) 13
DpnII GATC 1 cut(s) 11
Eco47I GGWCC 1 cut(s) 199
EcoRI GAATTC 1 cut(s) 214
FaiI YATR 1 cut(s) 131
FauI CCCGC 1 cut(s) 95
FblI GTMKAC 1 cut(s) 114
HapII CCGG 1 cut(s) 31
HincII GTYRAC 1 cut(s) 115
HindII GTYRAC 1 cut(s) 115
HpaII CCGG 1 cut(s) 31
HphI GGTGA 2 cut(s) 68, 196
Hpy166II GTNNAC 1 cut(s) 115
Hpy188I TCNGA 1 cut(s) 83
Hpy188III TCNNGA 2 cut(s) 9, 91
Hpy8I GTNNAC 1 cut(s) 115
Hpy99I CGWCG 2 cut(s) 39, 119
HpyCH4III ACNGT 1 cut(s) 119
HpyCH4IV ACGT 1 cut(s) 37
HpyF10VI GCNNNNNNNGC 2 cut(s) 40, 159
HpySE526I ACGT 1 cut(s) 37
Kzo9I GATC 1 cut(s) 11
LpnPI CCDG 1 cut(s) 44
MaeII ACGT 1 cut(s) 37
MalI GATC 1 cut(s) 13
MboI GATC 1 cut(s) 11
MboII GAAGA 1 cut(s) 158
MluCI AATT 1 cut(s) 214
MnlI CCTC 4 cut(s) 31, 52, 67, 118
MspI CCGG 1 cut(s) 31
MspR9I CCNGG 1 cut(s) 31
MwoI GCNNNNNNNGC 2 cut(s) 40, 159
NciI CCSGG 1 cut(s) 31
NdeII GATC 1 cut(s) 11
PflMI CCANNNNNTGG 1 cut(s) 53
PspPI GGNCC 1 cut(s) 199
SalI GTCGAC 1 cut(s) 113
Sau3AI GATC 1 cut(s) 11
Sau96I GGNCC 1 cut(s) 199
ScrFI CCNGG 1 cut(s) 31
SetI ASST 4 cut(s) 40, 45, 63, 155
SinI GGWCC 1 cut(s) 199
Sse9I AATT 1 cut(s) 214
SsiI CCGC 2 cut(s) 102, 182
StyD4I CCNGG 1 cut(s) 29
TaaI ACNGT 1 cut(s) 119
TaiI ACGT 1 cut(s) 40
TaqI TCGA 1 cut(s) 114
TasI AATT 1 cut(s) 214
Van91I CCANNNNNTGG 1 cut(s) 53
VpaK11BI GGWCC 1 cut(s) 199
XapI RAATTY 1 cut(s) 214
XmiI GTMKAC 1 cut(s) 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.