Rh1BG347000

Coiled-coil domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
OG0002738
Physical Location & Seq
Forward (+)
48033780 .. 48034052
273 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG347000.1

Sequence Viewer

Length: 273 bp
ATGGAAGACTCGCCTGAAATACTACGAAACTCGCTCCAAAACTCCGGCATTCGGGTCCCTTACGACGTGTCATCTGTCCGAGACCTCACACCGGCCACTTTAGTCTCGATCTGTGGCCAATCCCTCAGCCTCATCGTCGAAACGTCATCGTTTCCGACCTCACTTCTCGATTCCTCCATCACCGACCAGTTCAACGTCTGTATGGACATGGCTTCCGGGATCAACAGCCTCGGCTACCCAGGCAACGTGAGCTTCCACAAGGTACAGAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF812

Protein Analysis

90

Amino Acids

9.7

Weight (kDa)

4.31

Isoelectric Point (pI)

57.39

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CCDC22_N PF21674 1 - 87 1.1e-17 CCDC22 protein N-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 227
AcoI YGGCCR 2 cut(s) 93, 115
AfaI GTAC 1 cut(s) 264
AfiI CCNNNNNNNGG 2 cut(s) 51, 91
AflIII ACRYGT 1 cut(s) 66
AgsI TTSAA 1 cut(s) 193
AjiI CACGTC 1 cut(s) 67
AjnI CCWGG 1 cut(s) 238
AluBI AGCT 1 cut(s) 252
AluI AGCT 1 cut(s) 252
Alw26I GTCTC 2 cut(s) 75, 109
AlwI GGATC 1 cut(s) 227
AoxI GGCC 2 cut(s) 93, 115
AspS9I GGNCC 1 cut(s) 55
AsuC2I CCSGG 1 cut(s) 217
AsuHPI GGTGA 1 cut(s) 172
AvaII GGWCC 1 cut(s) 55
BalI TGGCCA 1 cut(s) 117
BbsI GAAGAC 1 cut(s) 12
BbvCI CCTCAGC 1 cut(s) 125
BccI CCATC 1 cut(s) 185
BciT130I CCWGG 1 cut(s) 240
BcnI CCSGG 1 cut(s) 217
BcoDI GTCTC 2 cut(s) 75, 109
Bme1390I CCNGG 2 cut(s) 217, 240
Bme18I GGWCC 1 cut(s) 55
BmgBI CACGTC 1 cut(s) 67
BmgT120I GGNCC 1 cut(s) 55
BmiI GGNNCC 2 cut(s) 56, 57
BmrFI CCNGG 2 cut(s) 217, 240
BpiI GAAGAC 1 cut(s) 12
Bpu10I CCTNAGC 1 cut(s) 125
BpuMI CCSGG 1 cut(s) 217
BsaI GGTCTC 1 cut(s) 75
BsaJI CCNNGG 2 cut(s) 229, 238
Bsc4I CCNNNNNNNGG 2 cut(s) 51, 91
Bse118I RCCGGY 1 cut(s) 91
Bse1I ACTGG 1 cut(s) 187
BseBI CCWGG 1 cut(s) 240
BseDI CCNNGG 2 cut(s) 229, 238
BseLI CCNNNNNNNGG 2 cut(s) 51, 91
BseMII CTCAG 1 cut(s) 139
BseNI ACTGG 1 cut(s) 187
BshFI GGCC 2 cut(s) 95, 117
BsiSI CCGG 3 cut(s) 45, 92, 216
BslFI GGGAC 1 cut(s) 41
BslI CCNNNNNNNGG 2 cut(s) 51, 91
BsmAI GTCTC 2 cut(s) 75, 109
BsmFI GGGAC 1 cut(s) 41
BsmI GAATGC 1 cut(s) 48
BsnI GGCC 2 cut(s) 95, 117
Bso31I GGTCTC 1 cut(s) 75
Bsp143I GATC 2 cut(s) 108, 219
BspANI GGCC 2 cut(s) 95, 117
BspCNI CTCAG 1 cut(s) 138
BspLI GGNNCC 2 cut(s) 56, 57
BspPI GGATC 1 cut(s) 227
BspTNI GGTCTC 1 cut(s) 75
BsrFI RCCGGY 1 cut(s) 91
BsrI ACTGG 1 cut(s) 187
BssAI RCCGGY 1 cut(s) 91
BssECI CCNNGG 2 cut(s) 229, 238
BssMI GATC 2 cut(s) 108, 219
Bst2UI CCWGG 1 cut(s) 240
BstDEI CTNAG 1 cut(s) 125
BstKTI GATC 2 cut(s) 111, 222
BstMAI GTCTC 2 cut(s) 75, 109
BstMBI GATC 2 cut(s) 108, 219
BstMWI GCNNNNNNNGC 2 cut(s) 240, 249
BstNI CCWGG 1 cut(s) 240
BstSCI CCNGG 2 cut(s) 215, 238
BstV2I GAAGAC 1 cut(s) 12
BsuRI GGCC 2 cut(s) 95, 117
BtrI CACGTC 1 cut(s) 67
Cfr10I RCCGGY 1 cut(s) 91
Cfr13I GGNCC 1 cut(s) 55
Csp6I GTAC 1 cut(s) 263
CviAII CATG 1 cut(s) 208
CviJI RGCY 7 cut(s) 95, 117, 129, 212, 228, 234, 252
CviKI_1 RGCY 7 cut(s) 95, 117, 129, 212, 228, 234, 252
CviQI GTAC 1 cut(s) 263
DdeI CTNAG 1 cut(s) 125
DpnI GATC 2 cut(s) 110, 221
DpnII GATC 2 cut(s) 108, 219
EaeI YGGCCR 2 cut(s) 93, 115
Eco31I GGTCTC 1 cut(s) 75
Eco47I GGWCC 1 cut(s) 55
EcoO109I RGGNCCY 1 cut(s) 55
EcoRII CCWGG 1 cut(s) 238
FaeI CATG 1 cut(s) 211
FaiI YATR 2 cut(s) 203, 209
FaqI GGGAC 1 cut(s) 41
FatI CATG 1 cut(s) 207
HaeIII GGCC 2 cut(s) 95, 117
HapII CCGG 3 cut(s) 45, 92, 216
Hin1II CATG 1 cut(s) 211
HinfI GANTC 2 cut(s) 8, 170
HpaII CCGG 3 cut(s) 45, 92, 216
HphI GGTGA 1 cut(s) 172
Hpy188I TCNGA 2 cut(s) 80, 156
Hpy188III TCNNGA 2 cut(s) 106, 167
Hpy99I CGWCG 2 cut(s) 68, 140
HpyCH4IV ACGT 4 cut(s) 66, 143, 195, 246
HpyF10VI GCNNNNNNNGC 2 cut(s) 240, 249
HpyF3I CTNAG 1 cut(s) 125
HpySE526I ACGT 4 cut(s) 66, 143, 195, 246
Hsp92II CATG 1 cut(s) 211
KflI GGGWCCC 1 cut(s) 55
Kzo9I GATC 2 cut(s) 108, 219
LmnI GCTCC 1 cut(s) 39
LpnPI CCDG 7 cut(s) 27, 58, 105, 200, 225, 229, 252
MaeII ACGT 4 cut(s) 66, 143, 195, 246
MalI GATC 2 cut(s) 110, 221
MboI GATC 2 cut(s) 108, 219
MboII GAAGA 1 cut(s) 17
MlsI TGGCCA 1 cut(s) 117
MluCI AATT 1 cut(s) 268
MluNI TGGCCA 1 cut(s) 117
MlyI GAGTC 1 cut(s) 2
MmeI TCCRAC 1 cut(s) 179
MnlI CCTC 6 cut(s) 95, 134, 140, 169, 184, 239
Mox20I TGGCCA 1 cut(s) 117
MscI TGGCCA 1 cut(s) 117
Msp20I TGGCCA 1 cut(s) 117
MspI CCGG 3 cut(s) 45, 92, 216
MspR9I CCNGG 2 cut(s) 217, 240
Mva1269I GAATGC 1 cut(s) 48
MvaI CCWGG 1 cut(s) 240
MwoI GCNNNNNNNGC 2 cut(s) 240, 249
NciI CCSGG 1 cut(s) 217
NdeII GATC 2 cut(s) 108, 219
NlaIII CATG 1 cut(s) 211
NlaIV GGNNCC 2 cut(s) 56, 57
NmeAIII GCCGAG 1 cut(s) 210
PctI GAATGC 1 cut(s) 48
PfeI GAWTC 1 cut(s) 170
PfoI TCCNGGA 1 cut(s) 215
PleI GAGTC 1 cut(s) 2
PpsI GAGTC 1 cut(s) 2
PpuMI RGGWCCY 1 cut(s) 55
Psp5II RGGWCCY 1 cut(s) 55
Psp6I CCWGG 1 cut(s) 238
PspGI CCWGG 1 cut(s) 238
PspN4I GGNNCC 2 cut(s) 56, 57
PspPI GGNCC 1 cut(s) 55
PspPPI RGGWCCY 1 cut(s) 55
RsaI GTAC 1 cut(s) 264
RsaNI GTAC 1 cut(s) 263
Sau3AI GATC 2 cut(s) 108, 219
Sau96I GGNCC 1 cut(s) 55
SchI GAGTC 1 cut(s) 2
ScrFI CCNGG 2 cut(s) 217, 240
SetI ASST 8 cut(s) 69, 87, 146, 161, 198, 249, 254, 264
SinI GGWCC 1 cut(s) 55
Sse9I AATT 1 cut(s) 268
StyD4I CCNGG 2 cut(s) 215, 238
TaiI ACGT 4 cut(s) 69, 146, 198, 249
TaqI TCGA 3 cut(s) 107, 138, 168
TasI AATT 1 cut(s) 268
TfiI GAWTC 1 cut(s) 170
VpaK11BI GGWCC 1 cut(s) 55
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.