Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr03

Orthogroup ID

OG0009327

Physical Location & Seq

Genomic Coordinates Forward (+)

36596011 .. 36596268

Gene Structure 258 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD03G1286500.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 126 bp

ATGACCATCAGAATGTTCATGGACACAAAACTAAATGCAATGCAGCATTCCGTTGCAACTTTGGAGAAATTATGCAAACGATATCATGTGCATAAAGATCGAAATCCCTTGATATTGACCCGTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Nop16

Protein Analysis

42

Amino Acids

4.94

Weight (kDa)

10.18

Isoelectric Point (pI)

19.47

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Nop16	PF09420	4 - 29	1e-05	Ribosome biogenesis protein Nop16

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009327)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G02870
fragaria_vesca	FvH4_2g25580
malus_domestica	MD03G1286500.v1.1 MD05G1198200.v1.1 MD11G1313700.v1.1
prunus_persica	Prupe.8G259900_v2.0.a1
pyrus_communis	pycom03g22710 pycom11g27260
rosa_chinensis	RchiOBHm_Chr2g0134071 RchiOBHm_Chr6g0293791
rosa_laevigata	RLG00000011923
rosa_multiflora	Rmu_sc0001782.1_g000027
rosa_roxburghii	Rroxscaffold_7G00173900
rosa_rugosa	Rorug06G0238100
rosa_samantha	Rh2BG373700 Rh2DG390300 Rh5BG142100 Rh6AG351400 Rh6BG358300 Rh6CG365400 Rh6DG352100
rosa_wichuraiana	Rw6G030570

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
ApeKI	GCWGC	1 cut(s)	43
BbvI	GCAGC	1 cut(s)	55
BccI	CCATC	1 cut(s)	14
BcgI	CGANNNNNNTGC	2 cut(s)	80, 114
BisI	GCNGC	1 cut(s)	44
BlsI	GCNGC	1 cut(s)	45
BsaBI	GATNNNNATC	1 cut(s)	102
Bse3DI	GCAATG	1 cut(s)	45
Bse8I	GATNNNNATC	1 cut(s)	102
BseJI	GATNNNNATC	1 cut(s)	102
BseMI	GCAATG	1 cut(s)	45
BseXI	GCAGC	1 cut(s)	55
BsmI	GAATGC	1 cut(s)	46
Bsp143I	GATC	1 cut(s)	97
BsrDI	GCAATG	1 cut(s)	45
BssMI	GATC	1 cut(s)	97
BstKTI	GATC	1 cut(s)	100
BstMBI	GATC	1 cut(s)	97
BstV1I	GCAGC	1 cut(s)	55
CviAII	CATG	2 cut(s)	19, 86
DpnI	GATC	1 cut(s)	99
DpnII	GATC	1 cut(s)	97
Eco32I	GATATC	1 cut(s)	83
EcoRV	GATATC	1 cut(s)	83
FaeI	CATG	2 cut(s)	22, 89
FaiI	YATR	4 cut(s)	20, 73, 87, 93
FatI	CATG	2 cut(s)	18, 85
Fnu4HI	GCNGC	1 cut(s)	44
Fsp4HI	GCNGC	1 cut(s)	44
FspEI	CC	6 cut(s)	5, 19, 47, 64, 120, 121
GluI	GCNGC	1 cut(s)	44
Hin1II	CATG	2 cut(s)	22, 89
Hpy188I	TCNGA	1 cut(s)	11
HpyCH4V	TGCA	5 cut(s)	38, 43, 56, 75, 91
Hsp92II	CATG	2 cut(s)	22, 89
Kzo9I	GATC	1 cut(s)	97
Lsp1109I	GCAGC	1 cut(s)	55
MalI	GATC	1 cut(s)	99
MboI	GATC	1 cut(s)	97
MluCI	AATT	1 cut(s)	68
MslI	CAYNNNNRTG	1 cut(s)	11
Mva1269I	GAATGC	1 cut(s)	46
NdeII	GATC	1 cut(s)	97
NlaIII	CATG	2 cut(s)	22, 89
PctI	GAATGC	1 cut(s)	46
PkrI	GCNGC	1 cut(s)	45
RseI	CAYNNNNRTG	1 cut(s)	11
SatI	GCNGC	1 cut(s)	44
Sau3AI	GATC	1 cut(s)	97
SgeI	CNNG	3 cut(s)	31, 98, 121
SmiMI	CAYNNNNRTG	1 cut(s)	11
Sse9I	AATT	1 cut(s)	68
TaqI	TCGA	1 cut(s)	100
TasI	AATT	1 cut(s)	68
TseI	GCWGC	1 cut(s)	43
TspDTI	ATGAA	1 cut(s)	7
TspGWI	ACGGA	1 cut(s)	40

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.