MD05G1198200.v1.1

Ribosome biogenesis protein Nop16

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
OG0009327
Physical Location & Seq
Reverse (-)
32498686 .. 32498856
171 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1198200.v1.1.491

Sequence Viewer

Length: 171 bp
ATGCAGCGTCTTCATCTTGGTCGACTCATTGAGGAGTATGGCGATGACTATCAGAGAATGTTCATGGATACGAAACTAAATGCAATGCAGCATTCTGTTGCAACTTTGGAGAAATTATACAGACGATATCATGTGCATAAAGATAGAAATCCCTTGATATTGACATGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Nop16

Protein Analysis

57

Amino Acids

6.85

Weight (kDa)

8.93

Isoelectric Point (pI)

29.64

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Nop16 PF09420 4 - 43 1.2e-12 Ribosome biogenesis protein Nop16
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 22
AflIII ACRYGT 1 cut(s) 164
ApeKI GCWGC 2 cut(s) 4, 88
BbsI GAAGAC 1 cut(s) 2
BbvI GCAGC 2 cut(s) 16, 100
BciVI GTATCC 1 cut(s) 61
BfuI GTATCC 1 cut(s) 61
BisI GCNGC 2 cut(s) 5, 89
BlsI GCNGC 2 cut(s) 6, 90
BpiI GAAGAC 1 cut(s) 2
BsaBI GATNNNNATC 2 cut(s) 48, 147
Bse3DI GCAATG 1 cut(s) 90
Bse8I GATNNNNATC 2 cut(s) 48, 147
BseJI GATNNNNATC 2 cut(s) 48, 147
BseMI GCAATG 1 cut(s) 90
BseRI GAGGAG 1 cut(s) 47
BseXI GCAGC 2 cut(s) 16, 100
BsmI GAATGC 1 cut(s) 91
BsrDI GCAATG 1 cut(s) 90
BstNSI RCATGY 1 cut(s) 168
BstV1I GCAGC 2 cut(s) 16, 100
BstV2I GAAGAC 1 cut(s) 2
BsuI GTATCC 1 cut(s) 61
BtgZI GCGATG 1 cut(s) 57
CviAII CATG 3 cut(s) 64, 131, 165
Eco32I GATATC 1 cut(s) 128
EcoRV GATATC 1 cut(s) 128
FaeI CATG 3 cut(s) 67, 134, 168
FaiI YATR 6 cut(s) 39, 65, 118, 132, 138, 166
FatI CATG 3 cut(s) 63, 130, 164
FblI GTMKAC 1 cut(s) 22
Fnu4HI GCNGC 2 cut(s) 5, 89
Fsp4HI GCNGC 2 cut(s) 5, 89
FspEI CC 7 cut(s) 3, 17, 24, 50, 92, 165, 166
GluI GCNGC 2 cut(s) 5, 89
Hin1II CATG 3 cut(s) 67, 134, 168
HincII GTYRAC 1 cut(s) 23
HindII GTYRAC 1 cut(s) 23
HinfI GANTC 1 cut(s) 24
Hpy166II GTNNAC 1 cut(s) 23
Hpy188I TCNGA 1 cut(s) 54
Hpy8I GTNNAC 1 cut(s) 23
HpyCH4V TGCA 5 cut(s) 4, 83, 88, 101, 136
Hsp92II CATG 3 cut(s) 67, 134, 168
Lsp1109I GCAGC 2 cut(s) 16, 100
MluCI AATT 1 cut(s) 113
MlyI GAGTC 1 cut(s) 18
MnlI CCTC 1 cut(s) 25
Mva1269I GAATGC 1 cut(s) 91
NlaIII CATG 3 cut(s) 67, 134, 168
NspI RCATGY 1 cut(s) 168
PciI ACATGT 1 cut(s) 164
PctI GAATGC 1 cut(s) 91
PkrI GCNGC 2 cut(s) 6, 90
PleI GAGTC 1 cut(s) 18
PpsI GAGTC 1 cut(s) 18
PscI ACATGT 1 cut(s) 164
SalI GTCGAC 1 cut(s) 21
SatI GCNGC 2 cut(s) 5, 89
SchI GAGTC 1 cut(s) 18
SgeI CNNG 4 cut(s) 29, 76, 143, 166
Sse9I AATT 1 cut(s) 113
TaqI TCGA 1 cut(s) 22
TasI AATT 1 cut(s) 113
TseI GCWGC 2 cut(s) 4, 88
TspDTI ATGAA 1 cut(s) 52
XceI RCATGY 1 cut(s) 168
XmiI GTMKAC 1 cut(s) 22
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.