MD04G1039300.v1.1

Catalyzes the third of the four reactions of the long- chain fatty acids elongation cycle. This endoplasmic reticulum- bound enzymatic process, allows the addition of two carbons to the chain of long- and very long-chain fatty acids VLCFAs per cycle. This enzyme catalyzes the dehydration of the 3-hydroxyacyl-CoA intermediate into trans-2,3-enoyl-CoA, within each cycle of fatty acid elongation. Thereby, it participates to the production of VLCFAs of different chain lengths that are involved in multiple biological processes as precursors of membrane lipids and lipid mediators

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr04
OG0006547
Physical Location & Seq
Reverse (-)
4307822 .. 4308100
279 bp
Loading structure...
UTR
Exon/CDS
Intron
MD04G1039300.v1.1.491

Sequence Viewer

Length: 279 bp
ATGGCAGGACTATTATCCGCTCTCAGGCGCCTATACCTCTCCCTCTACAACTGGACTGTCTTCCTCGGGTGGTTTCAGGTACTGCATCTTGCTCTCAAGACTCTCAGTGAATCCGCCCATCAACATGTTTACAATGCCGTCGAATGCCATTTTCTTCTCGCCCAGTCCGCCGTCGTTTTGGAGATTGTTCATGGGCTAGTGGGTTTGGTGAGATATCCAGTAACAACAACACTGCCGCAAATCGATTCAAGATTGTATCTGACATGGGGAATCCTATAA

Protein Analysis

93

Amino Acids

10.45

Weight (kDa)

7.98

Isoelectric Point (pI)

38.4

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PTPLA PF04387 55 - 92 1.5e-07 Protein tyrosine phosphatase-like protein, PTPLA
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 27
AccBSI CCGCTC 1 cut(s) 20
AciI CCGC 4 cut(s) 18, 114, 168, 236
AcyI GRCGYC 1 cut(s) 28
AfaI GTAC 1 cut(s) 81
AfiI CCNNNNNNNGG 1 cut(s) 24
AflIII ACRYGT 1 cut(s) 124
AgsI TTSAA 1 cut(s) 249
AlwNI CAGNNNCTG 1 cut(s) 82
Ama87I CYCGRG 1 cut(s) 65
AspLEI GCGC 1 cut(s) 30
AsuHPI GGTGA 1 cut(s) 220
AvaI CYCGRG 1 cut(s) 65
BanI GGYRCC 1 cut(s) 27
BbsI GAAGAC 1 cut(s) 52
BccI CCATC 1 cut(s) 126
BceAI ACGGC 2 cut(s) 122, 155
BfaI CTAG 1 cut(s) 197
BfoI RGCGCY 1 cut(s) 31
BisI GCNGC 1 cut(s) 236
BlsI GCNGC 1 cut(s) 237
BmeT110I CYCGRG 1 cut(s) 65
BmiI GGNNCC 1 cut(s) 29
BmrI ACTGGG 1 cut(s) 157
BmsI GCATC 1 cut(s) 94
BmuI ACTGGG 1 cut(s) 157
BpiI GAAGAC 1 cut(s) 52
BpuEI CTTGAG 1 cut(s) 80
Bsa29I ATCGAT 1 cut(s) 243
BsaHI GRCGYC 1 cut(s) 28
BsaJI CCNNGG 1 cut(s) 64
Bsc4I CCNNNNNNNGG 1 cut(s) 24
Bse1I ACTGG 3 cut(s) 56, 163, 218
BseCI ATCGAT 1 cut(s) 243
BseDI CCNNGG 1 cut(s) 64
BseLI CCNNNNNNNGG 1 cut(s) 24
BseMII CTCAG 2 cut(s) 37, 118
BseNI ACTGG 3 cut(s) 56, 163, 218
BshNI GGYRCC 1 cut(s) 27
BshVI ATCGAT 1 cut(s) 243
BsiHKCI CYCGRG 1 cut(s) 65
BslI CCNNNNNNNGG 1 cut(s) 24
BsmI GAATGC 1 cut(s) 149
BsoBI CYCGRG 1 cut(s) 65
BspACI CCGC 4 cut(s) 18, 114, 168, 236
BspCNI CTCAG 2 cut(s) 36, 117
BspDI ATCGAT 1 cut(s) 243
BspLI GGNNCC 1 cut(s) 29
BspT107I GGYRCC 1 cut(s) 27
BsrBI CCGCTC 1 cut(s) 20
BsrI ACTGG 3 cut(s) 56, 163, 218
BssECI CCNNGG 1 cut(s) 64
BssNI GRCGYC 1 cut(s) 28
Bst4CI ACNGT 1 cut(s) 58
BstACI GRCGYC 1 cut(s) 28
BstDEI CTNAG 2 cut(s) 23, 104
BstH2I RGCGCY 1 cut(s) 31
BstHHI GCGC 1 cut(s) 30
BstMWI GCNNNNNNNGC 1 cut(s) 167
BstNSI RCATGY 1 cut(s) 128
BstV2I GAAGAC 1 cut(s) 52
Bsu15I ATCGAT 1 cut(s) 243
BsuTUI ATCGAT 1 cut(s) 243
BtsI GCAGTG 1 cut(s) 230
BtsIMutI CAGTG 2 cut(s) 112, 230
CaiI CAGNNNCTG 1 cut(s) 82
CfoI GCGC 1 cut(s) 30
ClaI ATCGAT 1 cut(s) 243
Csp6I GTAC 1 cut(s) 80
CviAII CATG 3 cut(s) 125, 191, 264
CviJI RGCY 1 cut(s) 196
CviKI_1 RGCY 1 cut(s) 196
CviQI GTAC 1 cut(s) 80
DdeI CTNAG 2 cut(s) 23, 104
DinI GGCGCC 1 cut(s) 29
EciI GGCGGA 2 cut(s) 103, 157
Eco32I GATATC 1 cut(s) 215
Eco88I CYCGRG 1 cut(s) 65
EcoRV GATATC 1 cut(s) 215
EgeI GGCGCC 1 cut(s) 29
EheI GGCGCC 1 cut(s) 29
FaeI CATG 3 cut(s) 128, 194, 267
FaiI YATR 5 cut(s) 34, 126, 192, 265, 277
FatI CATG 3 cut(s) 124, 190, 263
Fnu4HI GCNGC 1 cut(s) 236
Fsp4HI GCNGC 1 cut(s) 236
FspBI CTAG 1 cut(s) 197
GlaI GCGC 1 cut(s) 29
GluI GCNGC 1 cut(s) 236
HaeII RGCGCY 1 cut(s) 31
HhaI GCGC 1 cut(s) 30
Hin1I GRCGYC 1 cut(s) 28
Hin1II CATG 3 cut(s) 128, 194, 267
Hin6I GCGC 1 cut(s) 28
HinP1I GCGC 1 cut(s) 28
HinfI GANTC 4 cut(s) 100, 110, 245, 270
HphI GGTGA 1 cut(s) 220
Hpy166II GTNNAC 1 cut(s) 130
Hpy188I TCNGA 1 cut(s) 261
Hpy188III TCNNGA 2 cut(s) 97, 249
Hpy8I GTNNAC 1 cut(s) 130
Hpy99I CGWCG 2 cut(s) 143, 176
HpyCH4III ACNGT 1 cut(s) 58
HpyCH4V TGCA 1 cut(s) 85
HpyF10VI GCNNNNNNNGC 1 cut(s) 167
HpyF3I CTNAG 2 cut(s) 23, 104
Hsp92I GRCGYC 1 cut(s) 28
Hsp92II CATG 3 cut(s) 128, 194, 267
HspAI GCGC 1 cut(s) 28
KasI GGCGCC 1 cut(s) 27
LpnPI CCDG 5 cut(s) 10, 37, 62, 176, 231
LweI GCATC 1 cut(s) 94
MaeI CTAG 1 cut(s) 197
MaeIII GTNAC 1 cut(s) 220
MbiI CCGCTC 1 cut(s) 20
MboII GAAGA 2 cut(s) 52, 146
Mly113I GGCGCC 1 cut(s) 28
MlyI GAGTC 1 cut(s) 94
MnlI CCTC 3 cut(s) 47, 53, 74
MslI CAYNNNNRTG 1 cut(s) 123
Mva1269I GAATGC 1 cut(s) 149
MwoI GCNNNNNNNGC 1 cut(s) 167
NarI GGCGCC 1 cut(s) 28
NlaIII CATG 3 cut(s) 128, 194, 267
NlaIV GGNNCC 1 cut(s) 29
NspI RCATGY 1 cut(s) 128
PciI ACATGT 1 cut(s) 124
PctI GAATGC 1 cut(s) 149
PfeI GAWTC 3 cut(s) 110, 245, 270
PkrI GCNGC 1 cut(s) 237
PleI GAGTC 1 cut(s) 94
PluTI GGCGCC 1 cut(s) 31
PpsI GAGTC 1 cut(s) 94
PscI ACATGT 1 cut(s) 124
PspN4I GGNNCC 1 cut(s) 29
PstNI CAGNNNCTG 1 cut(s) 82
RsaI GTAC 1 cut(s) 81
RsaNI GTAC 1 cut(s) 80
RseI CAYNNNNRTG 1 cut(s) 123
SatI GCNGC 1 cut(s) 236
SchI GAGTC 1 cut(s) 94
SetI ASST 2 cut(s) 39, 81
SfaNI GCATC 1 cut(s) 94
SfoI GGCGCC 1 cut(s) 29
SmiMI CAYNNNNRTG 1 cut(s) 123
SmlI CTYRAG 1 cut(s) 95
SmoI CTYRAG 1 cut(s) 95
SsiI CCGC 4 cut(s) 18, 114, 168, 236
SspDI GGCGCC 1 cut(s) 27
SspMI CTAG 1 cut(s) 197
TaaI ACNGT 1 cut(s) 58
TaqI TCGA 2 cut(s) 141, 243
TauI GCSGC 1 cut(s) 238
TfiI GAWTC 3 cut(s) 110, 245, 270
TscAI CASTG 2 cut(s) 112, 237
TspDTI ATGAA 1 cut(s) 179
TspRI CASTG 2 cut(s) 112, 237
XceI RCATGY 1 cut(s) 128
XspI CTAG 1 cut(s) 197
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.