Rmu_co8061266.1_g000001

Catalyzes the third of the four reactions of the long- chain fatty acids elongation cycle. This endoplasmic reticulum- bound enzymatic process, allows the addition of two carbons to the chain of long- and very long-chain fatty acids VLCFAs per cycle. This enzyme catalyzes the dehydration of the 3-hydroxyacyl-CoA intermediate into trans-2,3-enoyl-CoA, within each cycle of fatty acid elongation. Thereby, it participates to the production of VLCFAs of different chain lengths that are involved in multiple biological processes as precursors of membrane lipids and lipid mediators

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8061266.1
Physical Location & Seq
Forward (+)
1 .. 356
356 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8061266.1_g000001.1.cds

Sequence Viewer

Length: 168 bp
aattctgagaagtattgtataaggatgccaaacaagtggaacttttcttttgattacatctgtgctgcgattgtagccctaggattctacgtcccaggcagtcctcacatgtacacgtatatgcttacgcagaggaagaaagttctttcaaaatctaaagcggagtag

Protein Analysis

55

Amino Acids

6.43

Weight (kDa)

9.47

Isoelectric Point (pI)

51.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 161
AfaI GTAC 1 cut(s) 113
AflIII ACRYGT 2 cut(s) 108, 114
AgsI TTSAA 1 cut(s) 150
AjnI CCWGG 1 cut(s) 94
ApeKI GCWGC 1 cut(s) 65
AspA2I CCTAGG 1 cut(s) 79
AvrII CCTAGG 1 cut(s) 79
BbvI GCAGC 1 cut(s) 52
BciT130I CCWGG 1 cut(s) 96
BfaI CTAG 1 cut(s) 80
BisI GCNGC 1 cut(s) 66
BlnI CCTAGG 1 cut(s) 79
BlsI GCNGC 1 cut(s) 67
Bme1390I CCNGG 1 cut(s) 96
BmrFI CCNGG 1 cut(s) 96
BmsI GCATC 1 cut(s) 15
BsaAI YACGTR 1 cut(s) 117
BsaJI CCNNGG 2 cut(s) 79, 94
BseBI CCWGG 1 cut(s) 96
BseDI CCNNGG 2 cut(s) 79, 94
BseGI GGATG 1 cut(s) 30
BseXI GCAGC 1 cut(s) 52
BslFI GGGAC 1 cut(s) 77
BsmFI GGGAC 1 cut(s) 77
Bsp1407I TGTACA 1 cut(s) 111
BspACI CCGC 1 cut(s) 161
BsrGI TGTACA 1 cut(s) 111
BssECI CCNNGG 2 cut(s) 79, 94
BssT1I CCWWGG 1 cut(s) 79
Bst2UI CCWGG 1 cut(s) 96
BstAUI TGTACA 1 cut(s) 111
BstBAI YACGTR 1 cut(s) 117
BstDEI CTNAG 1 cut(s) 6
BstF5I GGATG 1 cut(s) 30
BstMWI GCNNNNNNNGC 1 cut(s) 74
BstNI CCWGG 1 cut(s) 96
BstNSI RCATGY 1 cut(s) 112
BstSCI CCNGG 1 cut(s) 94
BstV1I GCAGC 1 cut(s) 52
BstXI CCANNNNNNTGG 1 cut(s) 36
BtsCI GGATG 1 cut(s) 30
Csp6I GTAC 1 cut(s) 112
CviAII CATG 1 cut(s) 109
CviJI RGCY 1 cut(s) 77
CviKI_1 RGCY 1 cut(s) 77
CviQI GTAC 1 cut(s) 112
DdeI CTNAG 1 cut(s) 6
Eco130I CCWWGG 1 cut(s) 79
EcoRII CCWGG 1 cut(s) 94
EcoT14I CCWWGG 1 cut(s) 79
ErhI CCWWGG 1 cut(s) 79
FaeI CATG 1 cut(s) 112
FaiI YATR 4 cut(s) 20, 110, 120, 122
FalI AAGNNNNNCTT 2 cut(s) 26, 58
FaqI GGGAC 1 cut(s) 77
FatI CATG 1 cut(s) 108
Fnu4HI GCNGC 1 cut(s) 66
FokI GGATG 1 cut(s) 37
Fsp4HI GCNGC 1 cut(s) 66
FspBI CTAG 1 cut(s) 80
GluI GCNGC 1 cut(s) 66
Hin1II CATG 1 cut(s) 112
HinfI GANTC 1 cut(s) 84
Hpy166II GTNNAC 1 cut(s) 114
Hpy188I TCNGA 1 cut(s) 7
Hpy8I GTNNAC 1 cut(s) 114
HpyCH4IV ACGT 2 cut(s) 90, 116
HpyF10VI GCNNNNNNNGC 1 cut(s) 74
HpyF3I CTNAG 1 cut(s) 6
HpySE526I ACGT 2 cut(s) 90, 116
Hsp92II CATG 1 cut(s) 112
LpnPI CCDG 2 cut(s) 81, 108
Lsp1109I GCAGC 1 cut(s) 52
LweI GCATC 1 cut(s) 15
MaeI CTAG 1 cut(s) 80
MaeII ACGT 2 cut(s) 90, 116
MboII GAAGA 1 cut(s) 148
MnlI CCTC 2 cut(s) 114, 126
MslI CAYNNNNRTG 1 cut(s) 119
MspR9I CCNGG 1 cut(s) 96
MvaI CCWGG 1 cut(s) 96
MwoI GCNNNNNNNGC 1 cut(s) 74
NlaIII CATG 1 cut(s) 112
NspI RCATGY 1 cut(s) 112
PciI ACATGT 1 cut(s) 108
PfeI GAWTC 1 cut(s) 84
PkrI GCNGC 1 cut(s) 67
Ppu21I YACGTR 1 cut(s) 117
PscI ACATGT 1 cut(s) 108
Psp6I CCWGG 1 cut(s) 94
PspGI CCWGG 1 cut(s) 94
RsaI GTAC 1 cut(s) 113
RsaNI GTAC 1 cut(s) 112
RseI CAYNNNNRTG 1 cut(s) 119
SatI GCNGC 1 cut(s) 66
ScrFI CCNGG 1 cut(s) 96
SetI ASST 2 cut(s) 93, 119
SfaNI GCATC 1 cut(s) 15
SgeI CNNG 6 cut(s) 46, 92, 107, 108, 121, 127
SmiMI CAYNNNNRTG 1 cut(s) 119
SsiI CCGC 1 cut(s) 161
SspMI CTAG 1 cut(s) 80
StyD4I CCNGG 1 cut(s) 94
StyI CCWWGG 1 cut(s) 79
TaiI ACGT 2 cut(s) 93, 119
TatI WGTACW 1 cut(s) 111
TfiI GAWTC 1 cut(s) 84
TseI GCWGC 1 cut(s) 65
XceI RCATGY 1 cut(s) 112
XmaJI CCTAGG 1 cut(s) 79
XspI CTAG 1 cut(s) 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.