pycom01g06670

Catalyzes the third of the four reactions of the long- chain fatty acids elongation cycle. This endoplasmic reticulum- bound enzymatic process, allows the addition of two carbons to the chain of long- and very long-chain fatty acids VLCFAs per cycle. This enzyme catalyzes the dehydration of the 3-hydroxyacyl-CoA intermediate into trans-2,3-enoyl-CoA, within each cycle of fatty acid elongation. Thereby, it participates to the production of VLCFAs of different chain lengths that are involved in multiple biological processes as precursors of membrane lipids and lipid mediators

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Reverse (-)
7181648 .. 7182190
543 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g06670.1

Sequence Viewer

Length: 225 bp
ATGGCGGTACCGTTATCCGCTCTCAGGCGCCTATACCTTTCCCTCTACAACTGGACTGTCTTCCTCGGATGGTTTCAGGTACTGTATCTTGCTCTCAAGACTCTCAATGAATCCGGCCACCAACATGTCTACAGTGCCGTCGAACGCCCTCTGCTTCTCGCCCAATCCGCTGCCGTTTTGGAGATTCTTCATGGGCTAGTGGGTTTGGTGAGATCGATCCAATAA

Protein Analysis

75

Amino Acids

8.35

Weight (kDa)

9.4

Isoelectric Point (pI)

39.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 7
AccB1I GGYRCC 2 cut(s) 7, 27
AccBSI CCGCTC 1 cut(s) 20
AccI GTMKAC 1 cut(s) 129
AciI CCGC 3 cut(s) 5, 18, 168
AclWI GGATC 1 cut(s) 211
AcoI YGGCCR 1 cut(s) 115
AcyI GRCGYC 1 cut(s) 28
AfaI GTAC 2 cut(s) 9, 81
AfiI CCNNNNNNNGG 1 cut(s) 24
AflIII ACRYGT 1 cut(s) 124
AlwI GGATC 1 cut(s) 211
AlwNI CAGNNNCTG 1 cut(s) 82
AoxI GGCC 1 cut(s) 115
ApeKI GCWGC 1 cut(s) 170
Asp718I GGTACC 1 cut(s) 7
AspLEI GCGC 1 cut(s) 30
AsuHPI GGTGA 1 cut(s) 220
BanI GGYRCC 2 cut(s) 7, 27
BbsI GAAGAC 1 cut(s) 52
BbvI GCAGC 1 cut(s) 157
BccI CCATC 1 cut(s) 63
BceAI ACGGC 2 cut(s) 122, 158
BfaI CTAG 1 cut(s) 197
BfmI CTRYAG 1 cut(s) 130
BfoI RGCGCY 1 cut(s) 31
BisI GCNGC 1 cut(s) 171
BlsI GCNGC 1 cut(s) 172
BmiI GGNNCC 2 cut(s) 9, 29
BpiI GAAGAC 1 cut(s) 52
BpuEI CTTGAG 1 cut(s) 80
Bsa29I ATCGAT 1 cut(s) 215
BsaHI GRCGYC 1 cut(s) 28
BsaJI CCNNGG 1 cut(s) 64
Bsc4I CCNNNNNNNGG 1 cut(s) 24
Bse1I ACTGG 1 cut(s) 56
BseCI ATCGAT 1 cut(s) 215
BseDI CCNNGG 1 cut(s) 64
BseGI GGATG 1 cut(s) 74
BseLI CCNNNNNNNGG 1 cut(s) 24
BseMII CTCAG 1 cut(s) 37
BseNI ACTGG 1 cut(s) 56
BseXI GCAGC 1 cut(s) 157
BshFI GGCC 1 cut(s) 117
BshNI GGYRCC 2 cut(s) 7, 27
BshVI ATCGAT 1 cut(s) 215
BsiSI CCGG 1 cut(s) 114
BslI CCNNNNNNNGG 1 cut(s) 24
BsnI GGCC 1 cut(s) 117
Bsp143I GATC 2 cut(s) 212, 216
BspACI CCGC 3 cut(s) 5, 18, 168
BspANI GGCC 1 cut(s) 117
BspCNI CTCAG 1 cut(s) 36
BspDI ATCGAT 1 cut(s) 215
BspLI GGNNCC 2 cut(s) 9, 29
BspPI GGATC 1 cut(s) 211
BspT107I GGYRCC 2 cut(s) 7, 27
BsrBI CCGCTC 1 cut(s) 20
BsrI ACTGG 1 cut(s) 56
BssECI CCNNGG 1 cut(s) 64
BssMI GATC 2 cut(s) 212, 216
BssNI GRCGYC 1 cut(s) 28
Bst4CI ACNGT 4 cut(s) 12, 58, 84, 134
BstACI GRCGYC 1 cut(s) 28
BstDEI CTNAG 1 cut(s) 23
BstF5I GGATG 1 cut(s) 74
BstH2I RGCGCY 1 cut(s) 31
BstHHI GCGC 1 cut(s) 30
BstKTI GATC 2 cut(s) 215, 219
BstMBI GATC 2 cut(s) 212, 216
BstMWI GCNNNNNNNGC 1 cut(s) 167
BstNSI RCATGY 1 cut(s) 128
BstSFI CTRYAG 1 cut(s) 130
BstV1I GCAGC 1 cut(s) 157
BstV2I GAAGAC 1 cut(s) 52
Bsu15I ATCGAT 1 cut(s) 215
BsuRI GGCC 1 cut(s) 117
BsuTUI ATCGAT 1 cut(s) 215
BtsCI GGATG 1 cut(s) 74
BtsIMutI CAGTG 1 cut(s) 139
CaiI CAGNNNCTG 1 cut(s) 82
CfoI GCGC 1 cut(s) 30
ClaI ATCGAT 1 cut(s) 215
Csp6I GTAC 2 cut(s) 8, 80
CviAII CATG 2 cut(s) 125, 191
CviJI RGCY 2 cut(s) 117, 196
CviKI_1 RGCY 2 cut(s) 117, 196
CviQI GTAC 2 cut(s) 8, 80
DdeI CTNAG 1 cut(s) 23
DinI GGCGCC 1 cut(s) 29
DpnI GATC 2 cut(s) 214, 218
DpnII GATC 2 cut(s) 212, 216
EaeI YGGCCR 1 cut(s) 115
EgeI GGCGCC 1 cut(s) 29
EheI GGCGCC 1 cut(s) 29
FaeI CATG 2 cut(s) 128, 194
FaiI YATR 3 cut(s) 34, 126, 192
FatI CATG 2 cut(s) 124, 190
FblI GTMKAC 1 cut(s) 129
Fnu4HI GCNGC 1 cut(s) 171
FokI GGATG 1 cut(s) 81
Fsp4HI GCNGC 1 cut(s) 171
FspBI CTAG 1 cut(s) 197
GlaI GCGC 1 cut(s) 29
GluI GCNGC 1 cut(s) 171
HaeII RGCGCY 1 cut(s) 31
HaeIII GGCC 1 cut(s) 117
HapII CCGG 1 cut(s) 114
HhaI GCGC 1 cut(s) 30
Hin1I GRCGYC 1 cut(s) 28
Hin1II CATG 2 cut(s) 128, 194
Hin6I GCGC 1 cut(s) 28
HinP1I GCGC 1 cut(s) 28
HinfI GANTC 3 cut(s) 100, 110, 184
HpaII CCGG 1 cut(s) 114
HphI GGTGA 1 cut(s) 220
Hpy166II GTNNAC 1 cut(s) 130
Hpy188I TCNGA 1 cut(s) 68
Hpy188III TCNNGA 1 cut(s) 97
Hpy8I GTNNAC 1 cut(s) 130
Hpy99I CGWCG 1 cut(s) 143
HpyCH4III ACNGT 4 cut(s) 12, 58, 84, 134
HpyF10VI GCNNNNNNNGC 1 cut(s) 167
HpyF3I CTNAG 1 cut(s) 23
Hsp92I GRCGYC 1 cut(s) 28
Hsp92II CATG 2 cut(s) 128, 194
HspAI GCGC 1 cut(s) 28
KasI GGCGCC 1 cut(s) 27
KpnI GGTACC 1 cut(s) 11
Kzo9I GATC 2 cut(s) 212, 216
LpnPI CCDG 4 cut(s) 10, 37, 62, 127
Lsp1109I GCAGC 1 cut(s) 157
MaeI CTAG 1 cut(s) 197
MalI GATC 2 cut(s) 214, 218
MbiI CCGCTC 1 cut(s) 20
MboI GATC 2 cut(s) 212, 216
MboII GAAGA 2 cut(s) 52, 179
Mly113I GGCGCC 1 cut(s) 28
MlyI GAGTC 1 cut(s) 94
MnlI CCTC 3 cut(s) 53, 74, 159
MslI CAYNNNNRTG 1 cut(s) 123
MspA1I CMGCKG 1 cut(s) 170
MspI CCGG 1 cut(s) 114
MwoI GCNNNNNNNGC 1 cut(s) 167
NarI GGCGCC 1 cut(s) 28
NdeII GATC 2 cut(s) 212, 216
NlaIII CATG 2 cut(s) 128, 194
NlaIV GGNNCC 2 cut(s) 9, 29
NspI RCATGY 1 cut(s) 128
PciI ACATGT 1 cut(s) 124
PfeI GAWTC 2 cut(s) 110, 184
PkrI GCNGC 1 cut(s) 172
PleI GAGTC 1 cut(s) 94
PluTI GGCGCC 1 cut(s) 31
PpsI GAGTC 1 cut(s) 94
PscI ACATGT 1 cut(s) 124
PspN4I GGNNCC 2 cut(s) 9, 29
PstNI CAGNNNCTG 1 cut(s) 82
RsaI GTAC 2 cut(s) 9, 81
RsaNI GTAC 2 cut(s) 8, 80
RseI CAYNNNNRTG 1 cut(s) 123
SatI GCNGC 1 cut(s) 171
Sau3AI GATC 2 cut(s) 212, 216
SchI GAGTC 1 cut(s) 94
SetI ASST 2 cut(s) 39, 81
SfcI CTRYAG 1 cut(s) 130
SfoI GGCGCC 1 cut(s) 29
SmiMI CAYNNNNRTG 1 cut(s) 123
SmlI CTYRAG 1 cut(s) 95
SmoI CTYRAG 1 cut(s) 95
SsiI CCGC 3 cut(s) 5, 18, 168
SspDI GGCGCC 1 cut(s) 27
SspMI CTAG 1 cut(s) 197
TaaI ACNGT 4 cut(s) 12, 58, 84, 134
TaqI TCGA 2 cut(s) 141, 215
TfiI GAWTC 2 cut(s) 110, 184
TscAI CASTG 1 cut(s) 139
TseI GCWGC 1 cut(s) 170
TspDTI ATGAA 2 cut(s) 123, 179
TspRI CASTG 1 cut(s) 139
XceI RCATGY 1 cut(s) 128
XmiI GTMKAC 1 cut(s) 129
XspI CTAG 1 cut(s) 197
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.