MD15G1313000.v1.1

Catalyzes the third of the four reactions of the long- chain fatty acids elongation cycle. This endoplasmic reticulum- bound enzymatic process, allows the addition of two carbons to the chain of long- and very long-chain fatty acids VLCFAs per cycle. This enzyme catalyzes the dehydration of the 3-hydroxyacyl-CoA intermediate into trans-2,3-enoyl-CoA, within each cycle of fatty acid elongation. Thereby, it participates to the production of VLCFAs of different chain lengths that are involved in multiple biological processes as precursors of membrane lipids and lipid mediators

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
OG0006547
Physical Location & Seq
Forward (+)
31573081 .. 31573990
910 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1313000.v1.1.491

Sequence Viewer

Length: 297 bp
ATGAAGGAGGCTCTTGGTTTTGCACCTTCATGGCTCTTGTGGCTCAGGTATAGCACCTTCATCTTGTTGTATCCAACTGGCATCACAAGTGAAGTTGGTCTAATATATATTGCCCTGCCACACATGAAGACCTCTGAGAAGTATTCTATAAGGATGCCAAACAAGTGGAACTTCTGTTTCGATTACTTCTATGCTGCAATCGTTGCCCTAGGAATCTATGTCCCAGGGATTCCTTACATGTACGGGTATATGCTTGGACAGAGGAAGAAAGCTCTTGCAAAGGCCAAAGGGGAGTAG

Protein Analysis

99

Amino Acids

11.29

Weight (kDa)

9.49

Isoelectric Point (pI)

48.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PTPLA PF04387 6 - 93 2.4e-30 Protein tyrosine phosphatase-like protein, PTPLA
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 242
AflIII ACRYGT 1 cut(s) 237
AjnI CCWGG 1 cut(s) 223
AluBI AGCT 1 cut(s) 272
AluI AGCT 1 cut(s) 272
AoxI GGCC 1 cut(s) 282
ApeKI GCWGC 1 cut(s) 194
AspA2I CCTAGG 1 cut(s) 208
AvrII CCTAGG 1 cut(s) 208
BarI GAAGNNNNNNTAC 2 cut(s) 41, 73
BbsI GAAGAC 1 cut(s) 134
BbvI GCAGC 1 cut(s) 181
BciT130I CCWGG 1 cut(s) 225
BciVI GTATCC 1 cut(s) 81
BfaI CTAG 1 cut(s) 209
BfuI GTATCC 1 cut(s) 81
BisI GCNGC 1 cut(s) 195
BlnI CCTAGG 1 cut(s) 208
BlsI GCNGC 1 cut(s) 196
Bme1390I CCNGG 1 cut(s) 225
BmrFI CCNGG 1 cut(s) 225
BmsI GCATC 2 cut(s) 90, 144
BpiI GAAGAC 1 cut(s) 134
Bpu10I CCTNAGC 1 cut(s) 44
BsaJI CCNNGG 3 cut(s) 208, 223, 224
Bse1I ACTGG 1 cut(s) 82
BseBI CCWGG 1 cut(s) 225
BseDI CCNNGG 3 cut(s) 208, 223, 224
BseGI GGATG 1 cut(s) 159
BseMII CTCAG 2 cut(s) 58, 126
BseNI ACTGG 1 cut(s) 82
BseXI GCAGC 1 cut(s) 181
BshFI GGCC 1 cut(s) 284
BslFI GGGAC 1 cut(s) 206
BsmFI GGGAC 1 cut(s) 206
BsnI GGCC 1 cut(s) 284
BspANI GGCC 1 cut(s) 284
BspCNI CTCAG 2 cut(s) 57, 127
BsrI ACTGG 1 cut(s) 82
BssECI CCNNGG 3 cut(s) 208, 223, 224
BssT1I CCWWGG 1 cut(s) 208
Bst2UI CCWGG 1 cut(s) 225
BstAPI GCANNNNNTGC 1 cut(s) 203
BstDEI CTNAG 2 cut(s) 44, 135
BstF5I GGATG 1 cut(s) 159
BstMWI GCNNNNNNNGC 2 cut(s) 40, 203
BstNI CCWGG 1 cut(s) 225
BstNSI RCATGY 1 cut(s) 241
BstSCI CCNGG 1 cut(s) 223
BstV1I GCAGC 1 cut(s) 181
BstV2I GAAGAC 1 cut(s) 134
BstXI CCANNNNNNTGG 1 cut(s) 165
BsuI GTATCC 1 cut(s) 81
BsuRI GGCC 1 cut(s) 284
BtsCI GGATG 1 cut(s) 159
Csp6I GTAC 1 cut(s) 241
CviAII CATG 3 cut(s) 30, 124, 238
CviJI RGCY 5 cut(s) 11, 34, 43, 272, 284
CviKI_1 RGCY 5 cut(s) 11, 34, 43, 272, 284
CviQI GTAC 1 cut(s) 241
DdeI CTNAG 2 cut(s) 44, 135
Eco130I CCWWGG 1 cut(s) 208
EcoRII CCWGG 1 cut(s) 223
EcoT14I CCWWGG 1 cut(s) 208
ErhI CCWWGG 1 cut(s) 208
FaeI CATG 3 cut(s) 33, 127, 241
FalI AAGNNNNNCTT 2 cut(s) 155, 187
FaqI GGGAC 1 cut(s) 206
FatI CATG 3 cut(s) 29, 123, 237
Fnu4HI GCNGC 1 cut(s) 195
FokI GGATG 1 cut(s) 166
Fsp4HI GCNGC 1 cut(s) 195
FspBI CTAG 1 cut(s) 209
GluI GCNGC 1 cut(s) 195
HaeIII GGCC 1 cut(s) 284
Hin1II CATG 3 cut(s) 33, 127, 241
HinfI GANTC 2 cut(s) 213, 229
Hpy188I TCNGA 1 cut(s) 136
HpyAV CCTTC 2 cut(s) 36, 67
HpyCH4V TGCA 3 cut(s) 23, 197, 278
HpyF10VI GCNNNNNNNGC 2 cut(s) 40, 203
HpyF3I CTNAG 2 cut(s) 44, 135
Hsp92II CATG 3 cut(s) 33, 127, 241
LpnPI CCDG 5 cut(s) 31, 63, 128, 210, 237
Lsp1109I GCAGC 1 cut(s) 181
LweI GCATC 2 cut(s) 90, 144
MaeI CTAG 1 cut(s) 209
MboII GAAGA 2 cut(s) 139, 277
MmeI TCCRAC 1 cut(s) 98
MnlI CCTC 2 cut(s) 142, 255
MslI CAYNNNNRTG 1 cut(s) 28
MspR9I CCNGG 1 cut(s) 225
MvaI CCWGG 1 cut(s) 225
MwoI GCNNNNNNNGC 2 cut(s) 40, 203
NlaIII CATG 3 cut(s) 33, 127, 241
NspI RCATGY 1 cut(s) 241
PasI CCCWGGG 1 cut(s) 224
PciI ACATGT 1 cut(s) 237
PfeI GAWTC 2 cut(s) 213, 229
PkrI GCNGC 1 cut(s) 196
PscI ACATGT 1 cut(s) 237
Psp6I CCWGG 1 cut(s) 223
PspGI CCWGG 1 cut(s) 223
RsaI GTAC 1 cut(s) 242
RsaNI GTAC 1 cut(s) 241
RseI CAYNNNNRTG 1 cut(s) 28
SatI GCNGC 1 cut(s) 195
ScrFI CCNGG 1 cut(s) 225
SetI ASST 5 cut(s) 28, 50, 59, 134, 274
SfaNI GCATC 2 cut(s) 90, 144
SmiMI CAYNNNNRTG 1 cut(s) 28
SspMI CTAG 1 cut(s) 209
StyD4I CCNGG 1 cut(s) 223
StyI CCWWGG 1 cut(s) 208
TaqI TCGA 1 cut(s) 180
TfiI GAWTC 2 cut(s) 213, 229
TseI GCWGC 1 cut(s) 194
TspDTI ATGAA 4 cut(s) 17, 18, 49, 140
XceI RCATGY 1 cut(s) 241
XmaJI CCTAGG 1 cut(s) 208
XspI CTAG 1 cut(s) 209
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.