MD05G1144200.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
OG0013723
Physical Location & Seq
Reverse (-)
27599193 .. 27600509
1317 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1144200.v1.1.491

Sequence Viewer

Length: 222 bp
ATGTGGATGTCAGAGCCTGGAAGTTCTATGACGCGGGGCACCATCCAACTGTTTGGGCAGGAGCTATCTGACATAGAGAAGGTGTTGAGGGTGCCCAAAGAGGATAGACACTTAAGCAAGCTACGACCCTTATTTCGTCGGTACGGTTTTCAACCCTTAGTTTCCGAGAGCCAGGGACGATCGAGTAAGTTTGGAGAAGGTAAGCAAGAAAACAGGGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

74

Amino Acids

8.47

Weight (kDa)

9.69

Isoelectric Point (pI)

73.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 38, 91
AccII CGCG 1 cut(s) 34
AciI CCGC 1 cut(s) 34
AfaI GTAC 1 cut(s) 143
AflII CTTAAG 1 cut(s) 112
AgsI TTSAA 1 cut(s) 152
AjnI CCWGG 2 cut(s) 16, 171
AluBI AGCT 2 cut(s) 64, 121
AluI AGCT 2 cut(s) 64, 121
AlwNI CAGNNNCTG 1 cut(s) 17
ArsI GACNNNNNNTTYG 2 cut(s) 117, 149
BaeGI GKGCMC 2 cut(s) 41, 96
BanI GGYRCC 2 cut(s) 38, 91
BccI CCATC 1 cut(s) 50
BciT130I CCWGG 2 cut(s) 18, 173
BfaI CTAG 1 cut(s) 220
BfrI CTTAAG 1 cut(s) 112
Bme1390I CCNGG 2 cut(s) 18, 173
BmiI GGNNCC 2 cut(s) 40, 93
BmrFI CCNGG 2 cut(s) 18, 173
BsaJI CCNNGG 1 cut(s) 172
BseBI CCWGG 2 cut(s) 18, 173
BseDI CCNNGG 1 cut(s) 172
BseGI GGATG 2 cut(s) 12, 42
BseSI GKGCMC 2 cut(s) 41, 96
Bsh1236I CGCG 1 cut(s) 34
Bsh1285I CGRYCG 1 cut(s) 182
BshNI GGYRCC 2 cut(s) 38, 91
BsiEI CGRYCG 1 cut(s) 182
BslFI GGGAC 1 cut(s) 189
BsmFI GGGAC 1 cut(s) 189
Bsp1286I GDGCHC 2 cut(s) 41, 96
Bsp143I GATC 1 cut(s) 179
BspACI CCGC 1 cut(s) 34
BspFNI CGCG 1 cut(s) 34
BspLI GGNNCC 2 cut(s) 40, 93
BspT107I GGYRCC 2 cut(s) 38, 91
BspTI CTTAAG 1 cut(s) 112
BssECI CCNNGG 1 cut(s) 172
BssMI GATC 1 cut(s) 179
Bst2UI CCWGG 2 cut(s) 18, 173
Bst4CI ACNGT 2 cut(s) 51, 146
BstAFI CTTAAG 1 cut(s) 112
BstC8I GCNNGC 1 cut(s) 119
BstDEI CTNAG 1 cut(s) 157
BstF5I GGATG 2 cut(s) 12, 42
BstFNI CGCG 1 cut(s) 34
BstKTI GATC 1 cut(s) 182
BstMBI GATC 1 cut(s) 179
BstMCI CGRYCG 1 cut(s) 182
BstNI CCWGG 2 cut(s) 18, 173
BstSCI CCNGG 2 cut(s) 16, 171
BstSLI GKGCMC 2 cut(s) 41, 96
BstUI CGCG 1 cut(s) 34
BstXI CCANNNNNNTGG 1 cut(s) 53
BtsCI GGATG 2 cut(s) 12, 42
Cac8I GCNNGC 1 cut(s) 119
CaiI CAGNNNCTG 1 cut(s) 17
CseI GACGC 1 cut(s) 40
Csp6I GTAC 1 cut(s) 142
CviJI RGCY 4 cut(s) 16, 64, 121, 171
CviKI_1 RGCY 4 cut(s) 16, 64, 121, 171
CviQI GTAC 1 cut(s) 142
DdeI CTNAG 1 cut(s) 157
DpnI GATC 1 cut(s) 181
DpnII GATC 1 cut(s) 179
EcoRII CCWGG 2 cut(s) 16, 171
FaiI YATR 2 cut(s) 29, 74
FaqI GGGAC 1 cut(s) 189
FauI CCCGC 1 cut(s) 27
FokI GGATG 2 cut(s) 19, 29
FspBI CTAG 1 cut(s) 220
HgaI GACGC 1 cut(s) 40
Hpy188I TCNGA 3 cut(s) 13, 70, 166
Hpy99I CGWCG 1 cut(s) 141
HpyAV CCTTC 2 cut(s) 73, 191
HpyCH4III ACNGT 2 cut(s) 51, 146
HpyF3I CTNAG 1 cut(s) 157
Kzo9I GATC 1 cut(s) 179
LmnI GCTCC 1 cut(s) 61
LpnPI CCDG 6 cut(s) 3, 30, 44, 158, 185, 199
MaeI CTAG 1 cut(s) 220
MalI GATC 1 cut(s) 181
MboI GATC 1 cut(s) 179
MhlI GDGCHC 2 cut(s) 41, 96
MmeI TCCRAC 1 cut(s) 70
MnlI CCTC 2 cut(s) 81, 94
MseI TTAA 1 cut(s) 113
MspCI CTTAAG 1 cut(s) 112
MspR9I CCNGG 2 cut(s) 18, 173
MvaI CCWGG 2 cut(s) 18, 173
MvnI CGCG 1 cut(s) 34
NdeII GATC 1 cut(s) 179
NlaIV GGNNCC 2 cut(s) 40, 93
Ple19I CGATCG 1 cut(s) 182
Psp6I CCWGG 2 cut(s) 16, 171
PspGI CCWGG 2 cut(s) 16, 171
PspN4I GGNNCC 2 cut(s) 40, 93
PstNI CAGNNNCTG 1 cut(s) 17
PvuI CGATCG 1 cut(s) 182
RsaI GTAC 1 cut(s) 143
RsaNI GTAC 1 cut(s) 142
SaqAI TTAA 1 cut(s) 113
Sau3AI GATC 1 cut(s) 179
ScrFI CCNGG 2 cut(s) 18, 173
SduI GDGCHC 2 cut(s) 41, 96
SetI ASST 4 cut(s) 66, 84, 123, 202
SmlI CTYRAG 1 cut(s) 112
SmoI CTYRAG 1 cut(s) 112
SsiI CCGC 1 cut(s) 34
SspMI CTAG 1 cut(s) 220
StyD4I CCNGG 2 cut(s) 16, 171
TaaI ACNGT 2 cut(s) 51, 146
TaqI TCGA 1 cut(s) 182
Tru1I TTAA 1 cut(s) 113
Tru9I TTAA 1 cut(s) 113
Vha464I CTTAAG 1 cut(s) 112
XspI CTAG 1 cut(s) 220
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.