pycom04g18140

Zinc finger MYM-type protein 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr4
OG0013723
Physical Location & Seq
Forward (+)
20282025 .. 20282510
486 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom04g18140.1

Sequence Viewer

Length: 486 bp
ATGGATGATGTCAAGAATATAAGCAAAGCTTTGACTAAGGTCTTCCAGCTCAAGGACCAAACCTTGGAGGGGTTGAAGAGGCGGAATGATGAGAACTTACAGCTCAAGAAGCAGTTGGAGGCGACTATCCTCGAGGTTTCCAAGGTCAAAGGGAAGATTGAAAAGCTAAAGAAGAGTCTCCCAGTTAAGAGGGAAACTATTGTGGGGGAGTTCTTAGGACCCAGGTATTCCGTCATGTCATCAGGCCCCACTGCGCCCGAGAGATTCGGTTTGAGAAAAGGAAGTGGATGGCCATCATTGAGCGACACGACGCCGGATGCATTATCGGCAAGTACCATGCGGAGATGGAGGAGCAACTGCAAAATGGCAAACTCGATCCCAATAGTGGTGATGAGTCTGAGGATGACACCAATGCTGATGAGCAAACTCAGCAGGGTAAAGATGGTCCCGAAGATGCCAAGGATGACGATGATGGAGATGGAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4371 Dimer_Tnp_hAT

Protein Analysis

162

Amino Acids

18.26

Weight (kDa)

10.25

Isoelectric Point (pI)

54.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AbsI CCTCGAGG 1 cut(s) 131
AccB7I CCANNNNNTGG 1 cut(s) 64
AciI CCGC 2 cut(s) 82, 340
AclWI GGATC 1 cut(s) 370
AcoI YGGCCR 1 cut(s) 290
AcyI GRCGYC 1 cut(s) 311
AfaI GTAC 1 cut(s) 334
AfiI CCNNNNNNNGG 4 cut(s) 52, 64, 69, 385
AgsI TTSAA 2 cut(s) 76, 161
AjnI CCWGG 1 cut(s) 221
AluBI AGCT 4 cut(s) 29, 49, 103, 166
AluI AGCT 4 cut(s) 29, 49, 103, 166
Alw26I GTCTC 1 cut(s) 182
AlwI GGATC 1 cut(s) 370
Ama87I CYCGRG 2 cut(s) 131, 257
AoxI GGCC 2 cut(s) 244, 290
AspLEI GCGC 1 cut(s) 256
AspS9I GGNCC 4 cut(s) 55, 218, 245, 445
AsuHPI GGTGA 1 cut(s) 400
AvaI CYCGRG 2 cut(s) 131, 257
AvaII GGWCC 3 cut(s) 55, 218, 445
BalI TGGCCA 1 cut(s) 292
BbsI GAAGAC 1 cut(s) 34
BccI CCATC 6 cut(s) 282, 301, 339, 436, 466, 472
BciT130I CCWGG 1 cut(s) 223
BcoDI GTCTC 1 cut(s) 182
Bme1390I CCNGG 1 cut(s) 223
Bme18I GGWCC 3 cut(s) 55, 218, 445
BmeT110I CYCGRG 2 cut(s) 131, 257
BmgT120I GGNCC 4 cut(s) 55, 218, 245, 445
BmiI GGNNCC 3 cut(s) 220, 247, 447
BmrFI CCNGG 1 cut(s) 223
BmrI ACTGGG 1 cut(s) 176
BmsI GCATC 2 cut(s) 307, 444
BmuI ACTGGG 1 cut(s) 176
BoxI GACNNNNGTC 1 cut(s) 38
BpiI GAAGAC 1 cut(s) 34
BpuEI CTTGAG 2 cut(s) 35, 89
BsaBI GATNNNNATC 1 cut(s) 292
BsaHI GRCGYC 1 cut(s) 311
BsaJI CCNNGG 4 cut(s) 63, 141, 221, 458
BsaXI ACNNNNNCTCC 1 cut(s) 467
Bsc4I CCNNNNNNNGG 4 cut(s) 52, 64, 69, 385
Bse1I ACTGG 1 cut(s) 182
Bse8I GATNNNNATC 1 cut(s) 292
BseBI CCWGG 1 cut(s) 223
BseDI CCNNGG 4 cut(s) 63, 141, 221, 458
BseGI GGATG 5 cut(s) 10, 293, 322, 408, 468
BseJI GATNNNNATC 1 cut(s) 292
BseLI CCNNNNNNNGG 4 cut(s) 52, 64, 69, 385
BseMII CTCAG 2 cut(s) 389, 442
BseNI ACTGG 1 cut(s) 182
BseRI GAGGAG 1 cut(s) 364
BshFI GGCC 2 cut(s) 246, 292
BsiHKCI CYCGRG 2 cut(s) 131, 257
BsiSI CCGG 1 cut(s) 314
BslFI GGGAC 1 cut(s) 431
BslI CCNNNNNNNGG 4 cut(s) 52, 64, 69, 385
BsmAI GTCTC 1 cut(s) 182
BsmFI GGGAC 1 cut(s) 431
BsnI GGCC 2 cut(s) 246, 292
BsoBI CYCGRG 2 cut(s) 131, 257
Bsp143I GATC 1 cut(s) 375
BspACI CCGC 2 cut(s) 82, 340
BspANI GGCC 2 cut(s) 246, 292
BspCNI CTCAG 2 cut(s) 390, 441
BspLI GGNNCC 3 cut(s) 220, 247, 447
BspPI GGATC 1 cut(s) 370
BsrI ACTGG 1 cut(s) 182
BssECI CCNNGG 4 cut(s) 63, 141, 221, 458
BssMI GATC 1 cut(s) 375
BssNI GRCGYC 1 cut(s) 311
BssT1I CCWWGG 3 cut(s) 63, 141, 458
Bst2UI CCWGG 1 cut(s) 223
Bst6I CTCTTC 2 cut(s) 71, 167
BstACI GRCGYC 1 cut(s) 311
BstDEI CTNAG 4 cut(s) 36, 214, 398, 428
BstF5I GGATG 5 cut(s) 10, 293, 322, 408, 468
BstHHI GCGC 1 cut(s) 256
BstKTI GATC 1 cut(s) 378
BstMAI GTCTC 1 cut(s) 182
BstMBI GATC 1 cut(s) 375
BstMWI GCNNNNNNNGC 3 cut(s) 109, 326, 429
BstNI CCWGG 1 cut(s) 223
BstPAI GACNNNNGTC 1 cut(s) 38
BstSCI CCNGG 1 cut(s) 221
BstV2I GAAGAC 1 cut(s) 34
BsuRI GGCC 2 cut(s) 246, 292
BtsCI GGATG 5 cut(s) 10, 293, 322, 408, 468
BtsI GCAGTG 1 cut(s) 249
BtsIMutI CAGTG 1 cut(s) 249
CfoI GCGC 1 cut(s) 256
Cfr13I GGNCC 4 cut(s) 55, 218, 245, 445
CseI GACGC 1 cut(s) 319
Csp6I GTAC 1 cut(s) 333
CviAII CATG 2 cut(s) 235, 337
CviJI RGCY 6 cut(s) 29, 49, 103, 166, 246, 292
CviKI_1 RGCY 6 cut(s) 29, 49, 103, 166, 246, 292
CviQI GTAC 1 cut(s) 333
DdeI CTNAG 4 cut(s) 36, 214, 398, 428
DpnI GATC 1 cut(s) 377
DpnII GATC 1 cut(s) 375
EaeI YGGCCR 1 cut(s) 290
Eam1104I CTCTTC 2 cut(s) 71, 167
EarI CTCTTC 2 cut(s) 71, 167
EciI GGCGGA 1 cut(s) 97
Eco130I CCWWGG 3 cut(s) 63, 141, 458
Eco47I GGWCC 3 cut(s) 55, 218, 445
Eco88I CYCGRG 2 cut(s) 131, 257
EcoO109I RGGNCCY 2 cut(s) 218, 245
EcoRII CCWGG 1 cut(s) 221
EcoT14I CCWWGG 3 cut(s) 63, 141, 458
EcoT22I ATGCAT 1 cut(s) 322
ErhI CCWWGG 3 cut(s) 63, 141, 458
FaeI CATG 2 cut(s) 238, 340
FaiI YATR 3 cut(s) 20, 236, 338
FalI AAGNNNNNCTT 2 cut(s) 13, 45
FaqI GGGAC 1 cut(s) 431
FatI CATG 2 cut(s) 234, 336
FokI GGATG 5 cut(s) 17, 300, 329, 415, 475
GlaI GCGC 1 cut(s) 255
HaeIII GGCC 2 cut(s) 246, 292
HapII CCGG 1 cut(s) 314
HgaI GACGC 1 cut(s) 319
HhaI GCGC 1 cut(s) 256
Hin1I GRCGYC 1 cut(s) 311
Hin1II CATG 2 cut(s) 238, 340
Hin6I GCGC 1 cut(s) 254
HinP1I GCGC 1 cut(s) 254
HindIII AAGCTT 1 cut(s) 27
HinfI GANTC 3 cut(s) 175, 264, 394
HpaII CCGG 1 cut(s) 314
HphI GGTGA 1 cut(s) 400
Hpy188I TCNGA 1 cut(s) 399
Hpy188III TCNNGA 3 cut(s) 13, 106, 448
Hpy99I CGWCG 1 cut(s) 313
HpyCH4V TGCA 2 cut(s) 320, 360
HpyF10VI GCNNNNNNNGC 3 cut(s) 109, 326, 429
HpyF3I CTNAG 4 cut(s) 36, 214, 398, 428
Hsp92I GRCGYC 1 cut(s) 311
Hsp92II CATG 2 cut(s) 238, 340
HspAI GCGC 1 cut(s) 254
Kzo9I GATC 1 cut(s) 375
LmnI GCTCC 1 cut(s) 351
LpnPI CCDG 7 cut(s) 59, 195, 208, 228, 235, 327, 418
LweI GCATC 2 cut(s) 307, 444
MalI GATC 1 cut(s) 377
MboI GATC 1 cut(s) 375
MboII GAAGA 5 cut(s) 34, 88, 166, 184, 463
MlsI TGGCCA 1 cut(s) 292
MluNI TGGCCA 1 cut(s) 292
MlyI GAGTC 2 cut(s) 184, 403
MmeI TCCRAC 1 cut(s) 96
MnlI CCTC 8 cut(s) 61, 72, 112, 127, 140, 183, 342, 393
Mox20I TGGCCA 1 cut(s) 292
Mph1103I ATGCAT 1 cut(s) 322
MscI TGGCCA 1 cut(s) 292
MseI TTAA 1 cut(s) 186
Msp20I TGGCCA 1 cut(s) 292
MspI CCGG 1 cut(s) 314
MspR9I CCNGG 1 cut(s) 223
MvaI CCWGG 1 cut(s) 223
MwoI GCNNNNNNNGC 3 cut(s) 109, 326, 429
NdeII GATC 1 cut(s) 375
NlaIII CATG 2 cut(s) 238, 340
NlaIV GGNNCC 3 cut(s) 220, 247, 447
NsiI ATGCAT 1 cut(s) 322
PaeR7I CTCGAG 1 cut(s) 131
PfeI GAWTC 1 cut(s) 264
PflMI CCANNNNNTGG 1 cut(s) 64
PleI GAGTC 2 cut(s) 183, 402
PpsI GAGTC 2 cut(s) 183, 402
PpuMI RGGWCCY 1 cut(s) 218
PshAI GACNNNNGTC 1 cut(s) 38
Psp5II RGGWCCY 1 cut(s) 218
Psp6I CCWGG 1 cut(s) 221
PspGI CCWGG 1 cut(s) 221
PspN4I GGNNCC 3 cut(s) 220, 247, 447
PspPI GGNCC 4 cut(s) 55, 218, 245, 445
PspPPI RGGWCCY 1 cut(s) 218
PspXI VCTCGAGB 1 cut(s) 131
RsaI GTAC 1 cut(s) 334
RsaNI GTAC 1 cut(s) 333
SaqAI TTAA 1 cut(s) 186
Sau3AI GATC 1 cut(s) 375
Sau96I GGNCC 4 cut(s) 55, 218, 245, 445
SchI GAGTC 2 cut(s) 184, 403
ScrFI CCNGG 1 cut(s) 223
SetI ASST 9 cut(s) 31, 42, 51, 65, 105, 138, 147, 168, 227
SfaNI GCATC 2 cut(s) 307, 444
Sfr274I CTCGAG 1 cut(s) 131
SinI GGWCC 3 cut(s) 55, 218, 445
SlaI CTCGAG 1 cut(s) 131
SmlI CTYRAG 3 cut(s) 50, 104, 131
SmoI CTYRAG 3 cut(s) 50, 104, 131
SsiI CCGC 2 cut(s) 82, 340
StyD4I CCNGG 1 cut(s) 221
StyI CCWWGG 3 cut(s) 63, 141, 458
TaqI TCGA 2 cut(s) 132, 374
TfiI GAWTC 1 cut(s) 264
Tru1I TTAA 1 cut(s) 186
Tru9I TTAA 1 cut(s) 186
TscAI CASTG 1 cut(s) 256
TspGWI ACGGA 1 cut(s) 220
TspRI CASTG 1 cut(s) 256
Van91I CCANNNNNTGG 1 cut(s) 64
VpaK11BI GGWCC 3 cut(s) 55, 218, 445
XhoI CTCGAG 1 cut(s) 131
Zsp2I ATGCAT 1 cut(s) 322
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.