MD05G1203000.v1.1

Subtilisin-chymotrypsin inhibitor WSCI

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
OG0008933
Physical Location & Seq
Reverse (-)
33286004 .. 33286887
884 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1203000.v1.1.491

Sequence Viewer

Length: 210 bp
ATGGCGGAGTGTCCAGGTAAGAAGTCATGGCCAGAGCTGGTGGGAAAAAATGAGGAAAATGCGGCGGCAAAGATAGAGCAAGAGAATCACGGCCTGGGACAGCCCTGGTTACTGGAAGGGTCTGCAACCACCAGGGACAGAAGGTGCGATAGGGTCTGGGTCTGGATTAATGAACGCGGCGTCGTCACTAGGGTTCCTCGTGTTGGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
potato_inhibit

Protein Analysis

70

Amino Acids

7.81

Weight (kDa)

7.82

Isoelectric Point (pI)

43.42

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
potato_inhibit PF00280 7 - 69 6.6e-22 Potato inhibitor I family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 177
AciI CCGC 4 cut(s) 5, 62, 65, 177
AcoI YGGCCR 1 cut(s) 29
AcyI GRCGYC 1 cut(s) 180
AfiI CCNNNNNNNGG 1 cut(s) 203
AjnI CCWGG 4 cut(s) 13, 93, 104, 131
AluBI AGCT 1 cut(s) 37
AluI AGCT 1 cut(s) 37
AoxI GGCC 2 cut(s) 29, 91
AseI ATTAAT 1 cut(s) 168
BalI TGGCCA 1 cut(s) 31
BauI CACGAG 1 cut(s) 198
BceAI ACGGC 1 cut(s) 106
BciT130I CCWGG 4 cut(s) 15, 95, 106, 133
BfaI CTAG 1 cut(s) 189
BisI GCNGC 3 cut(s) 63, 66, 178
BlsI GCNGC 3 cut(s) 64, 67, 179
Bme1390I CCNGG 4 cut(s) 15, 95, 106, 133
BmiI GGNNCC 1 cut(s) 195
BmrFI CCNGG 4 cut(s) 15, 95, 106, 133
BsaHI GRCGYC 1 cut(s) 180
BsaJI CCNNGG 3 cut(s) 94, 104, 132
Bsc4I CCNNNNNNNGG 1 cut(s) 203
Bse1I ACTGG 1 cut(s) 117
BseBI CCWGG 4 cut(s) 15, 95, 106, 133
BseDI CCNNGG 3 cut(s) 94, 104, 132
BseLI CCNNNNNNNGG 1 cut(s) 203
BseNI ACTGG 1 cut(s) 117
Bsh1236I CGCG 1 cut(s) 177
BshFI GGCC 2 cut(s) 31, 93
BslFI GGGAC 2 cut(s) 111, 149
BslI CCNNNNNNNGG 1 cut(s) 203
BsmFI GGGAC 2 cut(s) 111, 149
BsnI GGCC 2 cut(s) 31, 93
BspACI CCGC 4 cut(s) 5, 62, 65, 177
BspANI GGCC 2 cut(s) 31, 93
BspFNI CGCG 1 cut(s) 177
BspLI GGNNCC 1 cut(s) 195
BsrI ACTGG 1 cut(s) 117
BssECI CCNNGG 3 cut(s) 94, 104, 132
BssNI GRCGYC 1 cut(s) 180
BssSI CACGAG 1 cut(s) 198
Bst2BI CACGAG 1 cut(s) 198
Bst2UI CCWGG 4 cut(s) 15, 95, 106, 133
BstACI GRCGYC 1 cut(s) 180
BstFNI CGCG 1 cut(s) 177
BstNI CCWGG 4 cut(s) 15, 95, 106, 133
BstSCI CCNGG 4 cut(s) 13, 93, 104, 131
BstUI CGCG 1 cut(s) 177
BsuRI GGCC 2 cut(s) 31, 93
CseI GACGC 1 cut(s) 169
CviAII CATG 1 cut(s) 27
CviJI RGCY 4 cut(s) 31, 37, 93, 103
CviKI_1 RGCY 4 cut(s) 31, 37, 93, 103
EaeI YGGCCR 1 cut(s) 29
EciI GGCGGA 1 cut(s) 20
EcoRII CCWGG 4 cut(s) 13, 93, 104, 131
FaeI CATG 1 cut(s) 30
FaiI YATR 1 cut(s) 28
FaqI GGGAC 2 cut(s) 111, 149
FatI CATG 1 cut(s) 26
Fnu4HI GCNGC 3 cut(s) 63, 66, 178
Fsp4HI GCNGC 3 cut(s) 63, 66, 178
FspBI CTAG 1 cut(s) 189
GluI GCNGC 3 cut(s) 63, 66, 178
HaeIII GGCC 2 cut(s) 31, 93
HgaI GACGC 1 cut(s) 169
Hin1I GRCGYC 1 cut(s) 180
Hin1II CATG 1 cut(s) 30
HinfI GANTC 1 cut(s) 85
Hpy188III TCNNGA 1 cut(s) 163
Hpy99I CGWCG 1 cut(s) 185
HpyAV CCTTC 2 cut(s) 110, 135
HpyCH4V TGCA 1 cut(s) 125
Hsp92I GRCGYC 1 cut(s) 180
Hsp92II CATG 1 cut(s) 30
MaeI CTAG 1 cut(s) 189
MaeIII GTNAC 2 cut(s) 108, 184
MlsI TGGCCA 1 cut(s) 31
MluNI TGGCCA 1 cut(s) 31
MnlI CCTC 2 cut(s) 46, 207
Mox20I TGGCCA 1 cut(s) 31
MscI TGGCCA 1 cut(s) 31
MseI TTAA 1 cut(s) 168
Msp20I TGGCCA 1 cut(s) 31
MspR9I CCNGG 4 cut(s) 15, 95, 106, 133
MvaI CCWGG 4 cut(s) 15, 95, 106, 133
MvnI CGCG 1 cut(s) 177
NlaIII CATG 1 cut(s) 30
NlaIV GGNNCC 1 cut(s) 195
NmuCI GTSAC 1 cut(s) 184
PfeI GAWTC 1 cut(s) 85
PkrI GCNGC 3 cut(s) 64, 67, 179
PshBI ATTAAT 1 cut(s) 168
Psp6I CCWGG 4 cut(s) 13, 93, 104, 131
PspGI CCWGG 4 cut(s) 13, 93, 104, 131
PspN4I GGNNCC 1 cut(s) 195
SaqAI TTAA 1 cut(s) 168
SatI GCNGC 3 cut(s) 63, 66, 178
ScrFI CCNGG 4 cut(s) 15, 95, 106, 133
SetI ASST 3 cut(s) 19, 39, 146
SsiI CCGC 4 cut(s) 5, 62, 65, 177
SspMI CTAG 1 cut(s) 189
StyD4I CCNGG 4 cut(s) 13, 93, 104, 131
TauI GCSGC 3 cut(s) 65, 68, 180
TfiI GAWTC 1 cut(s) 85
Tru1I TTAA 1 cut(s) 168
Tru9I TTAA 1 cut(s) 168
TseFI GTSAC 1 cut(s) 184
Tsp45I GTSAC 1 cut(s) 184
TspDTI ATGAA 1 cut(s) 186
VspI ATTAAT 1 cut(s) 168
XspI CTAG 1 cut(s) 189
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.