Prupe.8G229000_v2.0.a1

Subtilisin-chymotrypsin inhibitor WSCI

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
Physical Location & Seq
Reverse (-)
20491213 .. 20491691
479 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G229000.1

Sequence Viewer

Length: 180 bp
ATGCCACTTTGTCCAGGTGCAGGTAAAAAGTCGTGGCCGGAGGTGGTGGGGCAAAGTGGAGAAGATGCAGCGGCAAAGATAGAGCGAGAGAATCACAACGTTCGAGCAATCGTCATACTGGAAGGCTCTGCAACCACTTTGGACAGGAGGTGTGACAGGGTCTGGGTCTGGGTCAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

60

Amino Acids

6.52

Weight (kDa)

6.54

Isoelectric Point (pI)

47.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 11
AciI CCGC 1 cut(s) 71
AclI AACGTT 1 cut(s) 99
AcoI YGGCCR 1 cut(s) 35
AfiI CCNNNNNNNGG 1 cut(s) 20
AjnI CCWGG 1 cut(s) 13
AlwNI CAGNNNCTG 1 cut(s) 162
AoxI GGCC 1 cut(s) 35
ApeKI GCWGC 1 cut(s) 68
BbvI GCAGC 1 cut(s) 80
BciT130I CCWGG 1 cut(s) 15
BfuAI ACCTGC 1 cut(s) 11
BisI GCNGC 2 cut(s) 69, 72
BlsI GCNGC 2 cut(s) 70, 73
Bme1390I CCNGG 1 cut(s) 15
BmrFI CCNGG 1 cut(s) 15
BmsI GCATC 1 cut(s) 55
Bsc4I CCNNNNNNNGG 1 cut(s) 20
Bse1I ACTGG 1 cut(s) 123
BseBI CCWGG 1 cut(s) 15
BseLI CCNNNNNNNGG 1 cut(s) 20
BseNI ACTGG 1 cut(s) 123
BseXI GCAGC 1 cut(s) 80
BsgI GTGCAG 1 cut(s) 39
BshFI GGCC 1 cut(s) 37
BsiSI CCGG 1 cut(s) 38
BslI CCNNNNNNNGG 1 cut(s) 20
BsnI GGCC 1 cut(s) 37
BspACI CCGC 1 cut(s) 71
BspANI GGCC 1 cut(s) 37
BspMI ACCTGC 1 cut(s) 11
BsrI ACTGG 1 cut(s) 123
Bst2UI CCWGG 1 cut(s) 15
BstNI CCWGG 1 cut(s) 15
BstSCI CCNGG 1 cut(s) 13
BstV1I GCAGC 1 cut(s) 80
BsuRI GGCC 1 cut(s) 37
BveI ACCTGC 1 cut(s) 11
CaiI CAGNNNCTG 1 cut(s) 162
CviJI RGCY 2 cut(s) 37, 126
CviKI_1 RGCY 2 cut(s) 37, 126
EaeI YGGCCR 1 cut(s) 35
EcoRII CCWGG 1 cut(s) 13
FaiI YATR 1 cut(s) 116
Fnu4HI GCNGC 2 cut(s) 69, 72
Fsp4HI GCNGC 2 cut(s) 69, 72
GluI GCNGC 2 cut(s) 69, 72
HaeIII GGCC 1 cut(s) 37
HapII CCGG 1 cut(s) 38
HinfI GANTC 1 cut(s) 91
HpaII CCGG 1 cut(s) 38
HpyAV CCTTC 1 cut(s) 116
HpyCH4IV ACGT 1 cut(s) 99
HpyCH4V TGCA 3 cut(s) 20, 68, 131
HpySE526I ACGT 1 cut(s) 99
LpnPI CCDG 8 cut(s) 6, 27, 51, 104, 130, 142, 148, 154
Lsp1109I GCAGC 1 cut(s) 80
LweI GCATC 1 cut(s) 55
MaeII ACGT 1 cut(s) 99
MaeIII GTNAC 1 cut(s) 152
MboII GAAGA 1 cut(s) 74
MfeI CAATTG 1 cut(s) 175
MluCI AATT 1 cut(s) 175
MnlI CCTC 2 cut(s) 34, 141
MspA1I CMGCKG 1 cut(s) 71
MspI CCGG 1 cut(s) 38
MspR9I CCNGG 1 cut(s) 15
MunI CAATTG 1 cut(s) 175
MvaI CCWGG 1 cut(s) 15
NmuCI GTSAC 1 cut(s) 152
PfeI GAWTC 1 cut(s) 91
PflFI GACNNNGTC 1 cut(s) 158
PkrI GCNGC 2 cut(s) 70, 73
Psp1406I AACGTT 1 cut(s) 99
Psp6I CCWGG 1 cut(s) 13
PspGI CCWGG 1 cut(s) 13
PstNI CAGNNNCTG 1 cut(s) 162
PsyI GACNNNGTC 1 cut(s) 158
SatI GCNGC 2 cut(s) 69, 72
ScrFI CCNGG 1 cut(s) 15
SetI ASST 5 cut(s) 19, 25, 45, 102, 152
SfaNI GCATC 1 cut(s) 55
Sse9I AATT 1 cut(s) 175
SsiI CCGC 1 cut(s) 71
StyD4I CCNGG 1 cut(s) 13
TaiI ACGT 1 cut(s) 102
TaqI TCGA 1 cut(s) 103
TasI AATT 1 cut(s) 175
TauI GCSGC 1 cut(s) 74
TfiI GAWTC 1 cut(s) 91
TseFI GTSAC 1 cut(s) 152
TseI GCWGC 1 cut(s) 68
Tsp45I GTSAC 1 cut(s) 152
Tth111I GACNNNGTC 1 cut(s) 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.