RH4DG031400

subtilisin inhibitor

Design Primers CRISPR Design

Basic Information

Type: Sequence Only
Biological Identity
rosa_samantha
Unknown
OG0008933
Physical Location & Seq
Reverse (-)
0 .. 0
1 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG031400.1

Sequence Viewer

Length: 174 bp
ATGGCAAGTTCTACTTCTACTGAAACAAAGAGTTCGTGGCCAGAGTTAGTTGGAACCAAAGGAGAGGAAGCAGCAGCCACCATAATCAAAGAAAACCCCTCTGTCAAAGCCCATACAGTAAACGAAGGATCCCTCGTCACCTGTGATATACGTCATGACAGAGTTCGTGTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
potato_inhibit

Protein Analysis

57

Amino Acids

6.13

Weight (kDa)

6.04

Isoelectric Point (pI)

27.12

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
potato_inhibit PF00280 10 - 57 4.8e-17 Potato inhibitor I family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 123, 136
AcoI YGGCCR 1 cut(s) 38
AlwI GGATC 2 cut(s) 123, 136
AoxI GGCC 1 cut(s) 38
ApeKI GCWGC 2 cut(s) 71, 74
AsuHPI GGTGA 1 cut(s) 130
BalI TGGCCA 1 cut(s) 40
BamHI GGATCC 1 cut(s) 128
BbvI GCAGC 2 cut(s) 83, 86
BfaI CTAG 1 cut(s) 172
BisI GCNGC 2 cut(s) 72, 75
BlsI GCNGC 2 cut(s) 73, 76
BmiI GGNNCC 2 cut(s) 55, 130
BseXI GCAGC 2 cut(s) 83, 86
BshFI GGCC 1 cut(s) 40
BsnI GGCC 1 cut(s) 40
Bsp143I GATC 1 cut(s) 128
BspANI GGCC 1 cut(s) 40
BspHI TCATGA 1 cut(s) 154
BspLI GGNNCC 2 cut(s) 55, 130
BspPI GGATC 2 cut(s) 123, 136
BssMI GATC 1 cut(s) 128
Bst4CI ACNGT 1 cut(s) 118
BstKTI GATC 1 cut(s) 131
BstMBI GATC 1 cut(s) 128
BstV1I GCAGC 2 cut(s) 83, 86
BstX2I RGATCY 1 cut(s) 128
BstYI RGATCY 1 cut(s) 128
BsuRI GGCC 1 cut(s) 40
CciI TCATGA 1 cut(s) 154
CviAII CATG 1 cut(s) 155
CviJI RGCY 3 cut(s) 40, 77, 110
CviKI_1 RGCY 3 cut(s) 40, 77, 110
DpnI GATC 1 cut(s) 130
DpnII GATC 1 cut(s) 128
EaeI YGGCCR 1 cut(s) 38
FaeI CATG 1 cut(s) 158
FaiI YATR 4 cut(s) 83, 114, 149, 156
FalI AAGNNNNNCTT 1 cut(s) 30
FatI CATG 1 cut(s) 154
Fnu4HI GCNGC 2 cut(s) 72, 75
Fsp4HI GCNGC 2 cut(s) 72, 75
FspBI CTAG 1 cut(s) 172
GluI GCNGC 2 cut(s) 72, 75
HaeIII GGCC 1 cut(s) 40
Hin1II CATG 1 cut(s) 158
HphI GGTGA 1 cut(s) 130
Hpy166II GTNNAC 1 cut(s) 121
Hpy188III TCNNGA 1 cut(s) 155
Hpy8I GTNNAC 1 cut(s) 121
HpyAV CCTTC 1 cut(s) 119
HpyCH4III ACNGT 1 cut(s) 118
HpyCH4IV ACGT 1 cut(s) 151
HpySE526I ACGT 1 cut(s) 151
Hsp92II CATG 1 cut(s) 158
Kzo9I GATC 1 cut(s) 128
LpnPI CCDG 2 cut(s) 54, 154
Lsp1109I GCAGC 2 cut(s) 83, 86
MaeI CTAG 1 cut(s) 172
MaeII ACGT 1 cut(s) 151
MaeIII GTNAC 1 cut(s) 136
MalI GATC 1 cut(s) 130
MboI GATC 1 cut(s) 128
MflI RGATCY 1 cut(s) 128
MlsI TGGCCA 1 cut(s) 40
MluNI TGGCCA 1 cut(s) 40
MmeI TCCRAC 1 cut(s) 31
MnlI CCTC 3 cut(s) 58, 109, 143
Mox20I TGGCCA 1 cut(s) 40
MscI TGGCCA 1 cut(s) 40
Msp20I TGGCCA 1 cut(s) 40
NdeII GATC 1 cut(s) 128
NlaIII CATG 1 cut(s) 158
NlaIV GGNNCC 2 cut(s) 55, 130
NmuCI GTSAC 1 cut(s) 136
PagI TCATGA 1 cut(s) 154
PkrI GCNGC 2 cut(s) 73, 76
PspN4I GGNNCC 2 cut(s) 55, 130
PsuI RGATCY 1 cut(s) 128
SatI GCNGC 2 cut(s) 72, 75
Sau3AI GATC 1 cut(s) 128
SetI ASST 2 cut(s) 143, 154
SgeI CNNG 6 cut(s) 18, 48, 53, 146, 153, 167
SspMI CTAG 1 cut(s) 172
TaaI ACNGT 1 cut(s) 118
TaiI ACGT 1 cut(s) 154
TseFI GTSAC 1 cut(s) 136
TseI GCWGC 2 cut(s) 71, 74
Tsp45I GTSAC 1 cut(s) 136
XspI CTAG 1 cut(s) 172
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.