RH4CG037500

subtilisin inhibitor

Design Primers CRISPR Design

Basic Information

Type: Sequence Only
Biological Identity
rosa_samantha
Unknown
OG0008933
Physical Location & Seq
Reverse (-)
0 .. 0
1 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG037500.1

Sequence Viewer

Length: 219 bp
ATGGCAAGTTCTACTTCTACTGAAACAAAGAGTTCGTGGCCAGAGTTAGTTGGAACCAATGGAGAGGAAGCAGCAGCCACCATAATCAAAGAAAACCCCTATGTCAAAGCCCATACAGTAAACGAAGGATCCCTCGTCACCTGTGATATACGTCATGACAGAGTTCGTGTCTGGATTGATGAGCGTAGGGTCGTCACTGAGGCCCCTAAGATTGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
potato_inhibit

Protein Analysis

72

Amino Acids

7.94

Weight (kDa)

5.6

Isoelectric Point (pI)

28.83

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
potato_inhibit PF00280 10 - 72 1.7e-23 Potato inhibitor I family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 123, 136
AcoI YGGCCR 1 cut(s) 38
AfiI CCNNNNNNNGG 1 cut(s) 212
AlwI GGATC 2 cut(s) 123, 136
AoxI GGCC 2 cut(s) 38, 201
ApeKI GCWGC 2 cut(s) 71, 74
AspS9I GGNCC 1 cut(s) 202
AsuHPI GGTGA 1 cut(s) 130
BalI TGGCCA 1 cut(s) 40
BamHI GGATCC 1 cut(s) 128
BbvI GCAGC 2 cut(s) 83, 86
BisI GCNGC 2 cut(s) 72, 75
BlsI GCNGC 2 cut(s) 73, 76
BmgT120I GGNCC 1 cut(s) 202
BmiI GGNNCC 3 cut(s) 55, 130, 204
Bsc4I CCNNNNNNNGG 1 cut(s) 212
BseLI CCNNNNNNNGG 1 cut(s) 212
BseMII CTCAG 1 cut(s) 189
BseXI GCAGC 2 cut(s) 83, 86
BshFI GGCC 2 cut(s) 40, 203
BslI CCNNNNNNNGG 1 cut(s) 212
BsnI GGCC 2 cut(s) 40, 203
Bsp143I GATC 1 cut(s) 128
BspANI GGCC 2 cut(s) 40, 203
BspCNI CTCAG 1 cut(s) 190
BspHI TCATGA 1 cut(s) 154
BspLI GGNNCC 3 cut(s) 55, 130, 204
BspPI GGATC 2 cut(s) 123, 136
BssMI GATC 1 cut(s) 128
Bst4CI ACNGT 1 cut(s) 118
BstDEI CTNAG 2 cut(s) 198, 207
BstKTI GATC 1 cut(s) 131
BstMBI GATC 1 cut(s) 128
BstV1I GCAGC 2 cut(s) 83, 86
BstX2I RGATCY 1 cut(s) 128
BstYI RGATCY 1 cut(s) 128
BsuRI GGCC 2 cut(s) 40, 203
BtsIMutI CAGTG 1 cut(s) 195
CciI TCATGA 1 cut(s) 154
Cfr13I GGNCC 1 cut(s) 202
CviAII CATG 1 cut(s) 155
CviJI RGCY 4 cut(s) 40, 77, 110, 203
CviKI_1 RGCY 4 cut(s) 40, 77, 110, 203
DdeI CTNAG 2 cut(s) 198, 207
DpnI GATC 1 cut(s) 130
DpnII GATC 1 cut(s) 128
EaeI YGGCCR 1 cut(s) 38
EcoO109I RGGNCCY 1 cut(s) 202
FaeI CATG 1 cut(s) 158
FaiI YATR 5 cut(s) 83, 102, 114, 149, 156
FalI AAGNNNNNCTT 1 cut(s) 30
FatI CATG 1 cut(s) 154
Fnu4HI GCNGC 2 cut(s) 72, 75
Fsp4HI GCNGC 2 cut(s) 72, 75
GluI GCNGC 2 cut(s) 72, 75
HaeIII GGCC 2 cut(s) 40, 203
Hin1II CATG 1 cut(s) 158
HphI GGTGA 1 cut(s) 130
Hpy166II GTNNAC 1 cut(s) 121
Hpy188III TCNNGA 2 cut(s) 155, 172
Hpy8I GTNNAC 1 cut(s) 121
HpyAV CCTTC 1 cut(s) 119
HpyCH4III ACNGT 1 cut(s) 118
HpyCH4IV ACGT 1 cut(s) 151
HpyF3I CTNAG 2 cut(s) 198, 207
HpySE526I ACGT 1 cut(s) 151
Hsp92II CATG 1 cut(s) 158
Kzo9I GATC 1 cut(s) 128
LpnPI CCDG 3 cut(s) 54, 154, 157
Lsp1109I GCAGC 2 cut(s) 83, 86
MaeII ACGT 1 cut(s) 151
MaeIII GTNAC 2 cut(s) 136, 193
MalI GATC 1 cut(s) 130
MboI GATC 1 cut(s) 128
MflI RGATCY 1 cut(s) 128
MlsI TGGCCA 1 cut(s) 40
MluNI TGGCCA 1 cut(s) 40
MmeI TCCRAC 1 cut(s) 31
MnlI CCTC 3 cut(s) 58, 143, 193
Mox20I TGGCCA 1 cut(s) 40
MscI TGGCCA 1 cut(s) 40
MseI TTAA 1 cut(s) 217
Msp20I TGGCCA 1 cut(s) 40
NdeII GATC 1 cut(s) 128
NlaIII CATG 1 cut(s) 158
NlaIV GGNNCC 3 cut(s) 55, 130, 204
NmuCI GTSAC 2 cut(s) 136, 193
PagI TCATGA 1 cut(s) 154
PkrI GCNGC 2 cut(s) 73, 76
PspN4I GGNNCC 3 cut(s) 55, 130, 204
PspPI GGNCC 1 cut(s) 202
PsuI RGATCY 1 cut(s) 128
SaqAI TTAA 1 cut(s) 217
SatI GCNGC 2 cut(s) 72, 75
Sau3AI GATC 1 cut(s) 128
Sau96I GGNCC 1 cut(s) 202
SetI ASST 2 cut(s) 143, 154
SgeI CNNG 8 cut(s) 18, 48, 53, 146, 153, 167, 179, 184
TaaI ACNGT 1 cut(s) 118
TaiI ACGT 1 cut(s) 154
Tru1I TTAA 1 cut(s) 217
Tru9I TTAA 1 cut(s) 217
TscAI CASTG 1 cut(s) 202
TseFI GTSAC 2 cut(s) 136, 193
TseI GCWGC 2 cut(s) 71, 74
Tsp45I GTSAC 2 cut(s) 136, 193
TspRI CASTG 1 cut(s) 202
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.