Rh4BG028600

subtilisin inhibitor

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
OG0008933
Physical Location & Seq
Forward (+)
5095207 .. 5095495
289 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG028600.1

Sequence Viewer

Length: 222 bp
ATGGCAAGTTCTACTTCTAAAACTGAAACAAAGAGTTCGTGGCCAGAGTTAGTTGGAACCAAAGGAGAGGAAGCAGCAGCCACCATAATCAAAGAAAACCCCTCTGTCAAAGCCCATACAGTAAACGAAGGATCCCTCGTCACCTGTGATATACGTCATGACAGAGTTCGTGTCTGGATTGATGAGCGTGGGGTCGTCACTGAGGCCCCTAAGATTGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
potato_inhibit

Protein Analysis

73

Amino Acids

7.91

Weight (kDa)

6.07

Isoelectric Point (pI)

25.15

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
potato_inhibit PF00280 11 - 73 4.6e-24 Potato inhibitor I family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 126, 139
AcoI YGGCCR 1 cut(s) 41
AfiI CCNNNNNNNGG 1 cut(s) 215
AlwI GGATC 2 cut(s) 126, 139
AoxI GGCC 2 cut(s) 41, 204
ApeKI GCWGC 2 cut(s) 74, 77
AspS9I GGNCC 1 cut(s) 205
AsuHPI GGTGA 1 cut(s) 133
BalI TGGCCA 1 cut(s) 43
BamHI GGATCC 1 cut(s) 131
BbvI GCAGC 2 cut(s) 86, 89
BisI GCNGC 2 cut(s) 75, 78
BlsI GCNGC 2 cut(s) 76, 79
BmgT120I GGNCC 1 cut(s) 205
BmiI GGNNCC 3 cut(s) 58, 133, 207
Bsc4I CCNNNNNNNGG 1 cut(s) 215
BseLI CCNNNNNNNGG 1 cut(s) 215
BseMII CTCAG 1 cut(s) 192
BseXI GCAGC 2 cut(s) 86, 89
BshFI GGCC 2 cut(s) 43, 206
BslI CCNNNNNNNGG 1 cut(s) 215
BsnI GGCC 2 cut(s) 43, 206
Bsp143I GATC 1 cut(s) 131
BspANI GGCC 2 cut(s) 43, 206
BspCNI CTCAG 1 cut(s) 193
BspHI TCATGA 1 cut(s) 157
BspLI GGNNCC 3 cut(s) 58, 133, 207
BspPI GGATC 2 cut(s) 126, 139
BssMI GATC 1 cut(s) 131
Bst4CI ACNGT 1 cut(s) 121
BstDEI CTNAG 2 cut(s) 201, 210
BstKTI GATC 1 cut(s) 134
BstMBI GATC 1 cut(s) 131
BstV1I GCAGC 2 cut(s) 86, 89
BstX2I RGATCY 1 cut(s) 131
BstYI RGATCY 1 cut(s) 131
BsuRI GGCC 2 cut(s) 43, 206
BtsIMutI CAGTG 1 cut(s) 198
CciI TCATGA 1 cut(s) 157
Cfr13I GGNCC 1 cut(s) 205
CviAII CATG 1 cut(s) 158
CviJI RGCY 4 cut(s) 43, 80, 113, 206
CviKI_1 RGCY 4 cut(s) 43, 80, 113, 206
DdeI CTNAG 2 cut(s) 201, 210
DpnI GATC 1 cut(s) 133
DpnII GATC 1 cut(s) 131
EaeI YGGCCR 1 cut(s) 41
EcoO109I RGGNCCY 1 cut(s) 205
FaeI CATG 1 cut(s) 161
FaiI YATR 4 cut(s) 86, 117, 152, 159
FalI AAGNNNNNCTT 1 cut(s) 30
FatI CATG 1 cut(s) 157
Fnu4HI GCNGC 2 cut(s) 75, 78
Fsp4HI GCNGC 2 cut(s) 75, 78
GluI GCNGC 2 cut(s) 75, 78
HaeIII GGCC 2 cut(s) 43, 206
Hin1II CATG 1 cut(s) 161
HphI GGTGA 1 cut(s) 133
Hpy166II GTNNAC 1 cut(s) 124
Hpy188III TCNNGA 2 cut(s) 158, 175
Hpy8I GTNNAC 1 cut(s) 124
HpyAV CCTTC 1 cut(s) 122
HpyCH4III ACNGT 1 cut(s) 121
HpyCH4IV ACGT 1 cut(s) 154
HpyF3I CTNAG 2 cut(s) 201, 210
HpySE526I ACGT 1 cut(s) 154
Hsp92II CATG 1 cut(s) 161
Kzo9I GATC 1 cut(s) 131
LpnPI CCDG 3 cut(s) 57, 157, 160
Lsp1109I GCAGC 2 cut(s) 86, 89
MaeII ACGT 1 cut(s) 154
MaeIII GTNAC 2 cut(s) 139, 196
MalI GATC 1 cut(s) 133
MboI GATC 1 cut(s) 131
MflI RGATCY 1 cut(s) 131
MlsI TGGCCA 1 cut(s) 43
MluNI TGGCCA 1 cut(s) 43
MmeI TCCRAC 1 cut(s) 34
MnlI CCTC 4 cut(s) 61, 112, 146, 196
Mox20I TGGCCA 1 cut(s) 43
MscI TGGCCA 1 cut(s) 43
MseI TTAA 1 cut(s) 220
Msp20I TGGCCA 1 cut(s) 43
NdeII GATC 1 cut(s) 131
NlaIII CATG 1 cut(s) 161
NlaIV GGNNCC 3 cut(s) 58, 133, 207
NmuCI GTSAC 2 cut(s) 139, 196
PagI TCATGA 1 cut(s) 157
PkrI GCNGC 2 cut(s) 76, 79
PspN4I GGNNCC 3 cut(s) 58, 133, 207
PspPI GGNCC 1 cut(s) 205
PsuI RGATCY 1 cut(s) 131
SaqAI TTAA 1 cut(s) 220
SatI GCNGC 2 cut(s) 75, 78
Sau3AI GATC 1 cut(s) 131
Sau96I GGNCC 1 cut(s) 205
SetI ASST 2 cut(s) 146, 157
SgeI CNNG 9 cut(s) 18, 51, 56, 149, 156, 170, 182, 187, 200
TaaI ACNGT 1 cut(s) 121
TaiI ACGT 1 cut(s) 157
Tru1I TTAA 1 cut(s) 220
Tru9I TTAA 1 cut(s) 220
TscAI CASTG 1 cut(s) 205
TseFI GTSAC 2 cut(s) 139, 196
TseI GCWGC 2 cut(s) 74, 77
Tsp45I GTSAC 2 cut(s) 139, 196
TspRI CASTG 1 cut(s) 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.