MD07G1076800.v1.1

BTB POZ domain-containing protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
Physical Location & Seq
Forward (+)
7328334 .. 7328612
279 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1076800.v1.1.491

Sequence Viewer

Length: 279 bp
ATGTCCACTGAGAATGTTGTACCTCTCATTTGTGTATCTCACTACCTGGAAAAGACTGAAAACCACAGCAAAAATAATCTGTTAAGTAAGGCACTTTCTTATTTTCAAGGGAGAATCCTCCCTAGCTGGAATGAAACTATCAAGGCTTTCCGAGCCACAGAAATGTTCCTCCAATGGTCCGTGAAGCTCGGTTTAATCGATGCCTGTATAGAGTCTGTCATTCAAAAGGCACTAGCTAATCCCAGCCTTATTGGACAGCCAATGAAGAATTTGATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

93

Amino Acids

10.38

Weight (kDa)

8.66

Isoelectric Point (pI)

50.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 268
AfaI GTAC 1 cut(s) 21
AgsI TTSAA 2 cut(s) 107, 224
AjnI CCWGG 1 cut(s) 45
AluBI AGCT 3 cut(s) 126, 187, 236
AluI AGCT 3 cut(s) 126, 187, 236
ApoI RAATTY 1 cut(s) 268
AspS9I GGNCC 1 cut(s) 177
AvaII GGWCC 1 cut(s) 177
BciT130I CCWGG 1 cut(s) 47
BfaI CTAG 2 cut(s) 123, 233
Bme1390I CCNGG 1 cut(s) 47
Bme18I GGWCC 1 cut(s) 177
BmgT120I GGNCC 1 cut(s) 177
BmrFI CCNGG 1 cut(s) 47
BmsI GCATC 1 cut(s) 190
Bsa29I ATCGAT 1 cut(s) 198
BseBI CCWGG 1 cut(s) 47
BseCI ATCGAT 1 cut(s) 198
BseYI CCCAGC 1 cut(s) 242
BshVI ATCGAT 1 cut(s) 198
BspDI ATCGAT 1 cut(s) 198
Bst2UI CCWGG 1 cut(s) 47
BstDEI CTNAG 1 cut(s) 9
BstMWI GCNNNNNNNGC 1 cut(s) 152
BstNI CCWGG 1 cut(s) 47
BstSCI CCNGG 1 cut(s) 45
Bsu15I ATCGAT 1 cut(s) 198
BsuTUI ATCGAT 1 cut(s) 198
BtsIMutI CAGTG 1 cut(s) 6
Cfr13I GGNCC 1 cut(s) 177
ClaI ATCGAT 1 cut(s) 198
Csp6I GTAC 1 cut(s) 20
CviJI RGCY 7 cut(s) 126, 146, 155, 187, 236, 246, 259
CviKI_1 RGCY 7 cut(s) 126, 146, 155, 187, 236, 246, 259
CviQI GTAC 1 cut(s) 20
DdeI CTNAG 1 cut(s) 9
Eco47I GGWCC 1 cut(s) 177
EcoRII CCWGG 1 cut(s) 45
FaiI YATR 2 cut(s) 209, 277
FspBI CTAG 2 cut(s) 123, 233
GsaI CCCAGC 1 cut(s) 246
HinfI GANTC 2 cut(s) 114, 212
Hpy166II GTNNAC 1 cut(s) 6
Hpy188I TCNGA 1 cut(s) 152
Hpy8I GTNNAC 1 cut(s) 6
HpyF10VI GCNNNNNNNGC 1 cut(s) 152
HpyF3I CTNAG 1 cut(s) 9
LpnPI CCDG 5 cut(s) 32, 59, 112, 217, 256
LweI GCATC 1 cut(s) 190
MaeI CTAG 2 cut(s) 123, 233
MboII GAAGA 1 cut(s) 277
MluCI AATT 1 cut(s) 268
MlyI GAGTC 1 cut(s) 221
MnlI CCTC 3 cut(s) 33, 128, 179
MseI TTAA 2 cut(s) 83, 194
MslI CAYNNNNRTG 1 cut(s) 161
MspR9I CCNGG 1 cut(s) 47
MvaI CCWGG 1 cut(s) 47
MwoI GCNNNNNNNGC 1 cut(s) 152
PcsI WCGNNNNNNNCGW 1 cut(s) 195
PfeI GAWTC 1 cut(s) 114
PleI GAGTC 1 cut(s) 220
PpsI GAGTC 1 cut(s) 220
Psp6I CCWGG 1 cut(s) 45
PspFI CCCAGC 1 cut(s) 242
PspGI CCWGG 1 cut(s) 45
PspPI GGNCC 1 cut(s) 177
RsaI GTAC 1 cut(s) 21
RsaNI GTAC 1 cut(s) 20
RseI CAYNNNNRTG 1 cut(s) 161
SaqAI TTAA 2 cut(s) 83, 194
Sau96I GGNCC 1 cut(s) 177
SchI GAGTC 1 cut(s) 221
ScrFI CCNGG 1 cut(s) 47
SetI ASST 5 cut(s) 25, 48, 128, 189, 238
SfaNI GCATC 1 cut(s) 190
SinI GGWCC 1 cut(s) 177
SmiMI CAYNNNNRTG 1 cut(s) 161
Sse9I AATT 1 cut(s) 268
SspMI CTAG 2 cut(s) 123, 233
StyD4I CCNGG 1 cut(s) 45
TaqI TCGA 1 cut(s) 198
TasI AATT 1 cut(s) 268
TfiI GAWTC 1 cut(s) 114
Tru1I TTAA 2 cut(s) 83, 194
Tru9I TTAA 2 cut(s) 83, 194
TscAI CASTG 1 cut(s) 13
TspDTI ATGAA 2 cut(s) 147, 278
TspGWI ACGGA 1 cut(s) 169
TspRI CASTG 1 cut(s) 13
VpaK11BI GGWCC 1 cut(s) 177
XapI RAATTY 1 cut(s) 268
XspI CTAG 2 cut(s) 123, 233
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.