Rh1CG250700

BTB POZ domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0009358
Physical Location & Seq
Forward (+)
51387069 .. 51393823
6755 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG250700.1

Sequence Viewer

Length: 492 bp
ATGAATTCTGAGGAGAAGCCACGAAATTTGGGGAGCGCTCGAATACAAGATCGCCTGTTGCCCAAGTCTACATCGGATATGCAACTAAATGTGCTTGGTGGTCAGCCATTCACTATGGACATAGAGCTTCTGGCTGCAAAATCAGCCAAATTTGCTGCTACACTCGAAGAGAATCTGCAGGAAGATCTTGCTAACTTCCTCCAAAGTGTCCCTGCTACTGCAGACACTCTTGAGCTTGTTGCAAGATTCTATCATGGCTTTGATATTCAAATTTTCAGTCAGAATGTTATACAGCTCATTTGTGTTGCTGACTACTTGGACATGACTGAAAGCCACAGCAAAGATAATTTATTAAACAAAGCTATTTCATATTTTCAACAAAGAATCCTCCCTAGCTGGTCTGAAACTATTAAGGCTTTCCGATCCACAGAAAAGGTATTTCAACAATCCTGGAAGCTTGGATTAGTACACGAATGTTTGGACTATCATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
BTB NPH3

Protein Analysis

163

Amino Acids

18.57

Weight (kDa)

5.16

Isoelectric Point (pI)

54.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 68
AclWI GGATC 1 cut(s) 417
AcsI RAATTY 4 cut(s) 4, 25, 149, 270
AfaI GTAC 1 cut(s) 468
AfeI AGCGCT 1 cut(s) 37
AgsI TTSAA 3 cut(s) 269, 377, 443
AjnI CCWGG 1 cut(s) 449
AluBI AGCT 6 cut(s) 127, 235, 295, 362, 396, 457
AluI AGCT 6 cut(s) 127, 235, 295, 362, 396, 457
AlwI GGATC 1 cut(s) 417
Aor51HI AGCGCT 1 cut(s) 37
ApeKI GCWGC 2 cut(s) 134, 155
ApoI RAATTY 4 cut(s) 4, 25, 149, 270
ArsI GACNNNNNNTTYG 2 cut(s) 262, 294
AspLEI GCGC 1 cut(s) 38
BbvI GCAGC 2 cut(s) 121, 142
BciT130I CCWGG 1 cut(s) 451
BfaI CTAG 1 cut(s) 393
BfmI CTRYAG 2 cut(s) 176, 219
BfoI RGCGCY 1 cut(s) 39
BglII AGATCT 1 cut(s) 184
BisI GCNGC 2 cut(s) 135, 156
BlsI GCNGC 2 cut(s) 136, 157
Bme1390I CCNGG 1 cut(s) 451
BmrFI CCNGG 1 cut(s) 451
BpuEI CTTGAG 1 cut(s) 251
BseBI CCWGG 1 cut(s) 451
BseRI GAGGAG 1 cut(s) 26
BseXI GCAGC 2 cut(s) 121, 142
BslFI GGGAC 1 cut(s) 194
BsmFI GGGAC 1 cut(s) 194
Bsp143I GATC 3 cut(s) 49, 184, 422
BspMAI CTGCAG 2 cut(s) 180, 223
BspPI GGATC 1 cut(s) 417
BssMI GATC 3 cut(s) 49, 184, 422
Bst2UI CCWGG 1 cut(s) 451
Bst6I CTCTTC 1 cut(s) 162
BstDEI CTNAG 1 cut(s) 9
BstH2I RGCGCY 1 cut(s) 39
BstHHI GCGC 1 cut(s) 38
BstKTI GATC 3 cut(s) 52, 187, 425
BstMBI GATC 3 cut(s) 49, 184, 422
BstMWI GCNNNNNNNGC 2 cut(s) 143, 152
BstNI CCWGG 1 cut(s) 451
BstSCI CCNGG 1 cut(s) 449
BstSFI CTRYAG 2 cut(s) 176, 219
BstV1I GCAGC 2 cut(s) 121, 142
BstX2I RGATCY 1 cut(s) 184
BstYI RGATCY 1 cut(s) 184
CfoI GCGC 1 cut(s) 38
Csp6I GTAC 1 cut(s) 467
CspCI CAANNNNNGTGG 2 cut(s) 9, 44
CviAII CATG 2 cut(s) 254, 322
CviQI GTAC 1 cut(s) 467
DdeI CTNAG 1 cut(s) 9
DpnI GATC 3 cut(s) 51, 186, 424
DpnII GATC 3 cut(s) 49, 184, 422
Eam1104I CTCTTC 1 cut(s) 162
EarI CTCTTC 1 cut(s) 162
Eco47III AGCGCT 1 cut(s) 37
EcoRI GAATTC 1 cut(s) 4
EcoRII CCWGG 1 cut(s) 449
FaeI CATG 2 cut(s) 257, 325
FaiI YATR 7 cut(s) 80, 116, 122, 255, 290, 323, 370
FaqI GGGAC 1 cut(s) 194
FatI CATG 2 cut(s) 253, 321
FblI GTMKAC 1 cut(s) 68
Fnu4HI GCNGC 2 cut(s) 135, 156
Fsp4HI GCNGC 2 cut(s) 135, 156
FspBI CTAG 1 cut(s) 393
GlaI GCGC 1 cut(s) 37
GluI GCNGC 2 cut(s) 135, 156
HaeII RGCGCY 1 cut(s) 39
HhaI GCGC 1 cut(s) 38
Hin1II CATG 2 cut(s) 257, 325
Hin6I GCGC 1 cut(s) 36
HinP1I GCGC 1 cut(s) 36
HindIII AAGCTT 1 cut(s) 455
HinfI GANTC 3 cut(s) 172, 246, 384
Hpy166II GTNNAC 2 cut(s) 69, 469
Hpy188I TCNGA 5 cut(s) 10, 76, 282, 403, 422
Hpy188III TCNNGA 1 cut(s) 230
Hpy8I GTNNAC 2 cut(s) 69, 469
HpyCH4V TGCA 5 cut(s) 82, 137, 178, 221, 242
HpyF10VI GCNNNNNNNGC 2 cut(s) 143, 152
HpyF3I CTNAG 1 cut(s) 9
Hsp92II CATG 2 cut(s) 257, 325
HspAI GCGC 1 cut(s) 36
Kzo9I GATC 3 cut(s) 49, 184, 422
LmnI GCTCC 1 cut(s) 33
LpnPI CCDG 7 cut(s) 68, 116, 164, 225, 382, 436, 463
Lsp1109I GCAGC 2 cut(s) 121, 142
MaeI CTAG 1 cut(s) 393
MalI GATC 3 cut(s) 51, 186, 424
MboI GATC 3 cut(s) 49, 184, 422
MboII GAAGA 2 cut(s) 179, 194
MflI RGATCY 1 cut(s) 184
MluCI AATT 5 cut(s) 4, 25, 149, 270, 346
MnlI CCTC 3 cut(s) 4, 209, 398
MseI TTAA 2 cut(s) 353, 411
MspR9I CCNGG 1 cut(s) 451
MvaI CCWGG 1 cut(s) 451
MwoI GCNNNNNNNGC 2 cut(s) 143, 152
NdeII GATC 3 cut(s) 49, 184, 422
NlaIII CATG 2 cut(s) 257, 325
PfeI GAWTC 3 cut(s) 172, 246, 384
PfoI TCCNGGA 1 cut(s) 449
PkrI GCNGC 2 cut(s) 136, 157
Psp6I CCWGG 1 cut(s) 449
PspGI CCWGG 1 cut(s) 449
PstI CTGCAG 2 cut(s) 180, 223
PsuI RGATCY 1 cut(s) 184
RsaI GTAC 1 cut(s) 468
RsaNI GTAC 1 cut(s) 467
SaqAI TTAA 2 cut(s) 353, 411
SatI GCNGC 2 cut(s) 135, 156
Sau3AI GATC 3 cut(s) 49, 184, 422
ScrFI CCNGG 1 cut(s) 451
SetI ASST 7 cut(s) 129, 237, 297, 364, 398, 438, 459
SfcI CTRYAG 2 cut(s) 176, 219
SmlI CTYRAG 1 cut(s) 230
SmoI CTYRAG 1 cut(s) 230
Sse9I AATT 5 cut(s) 4, 25, 149, 270, 346
SspMI CTAG 1 cut(s) 393
StyD4I CCNGG 1 cut(s) 449
TaqI TCGA 2 cut(s) 40, 165
TasI AATT 5 cut(s) 4, 25, 149, 270, 346
TatI WGTACW 1 cut(s) 466
TfiI GAWTC 3 cut(s) 172, 246, 384
Tru1I TTAA 2 cut(s) 353, 411
Tru9I TTAA 2 cut(s) 353, 411
TseI GCWGC 2 cut(s) 134, 155
TspDTI ATGAA 2 cut(s) 17, 357
XapI RAATTY 4 cut(s) 4, 25, 149, 270
XmiI GTMKAC 1 cut(s) 68
XspI CTAG 1 cut(s) 393
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.